sbuild (Debian sbuild) 0.86.3~bpo12+1 (03 November 2024) on debusine-worker-arm64-demeter-01.freexian.com
+==============================================================================+
| flexbar 1:3.5.0-5 (arm64) Sat, 23 Nov 2024 10:27:51 +0000 |
+==============================================================================+
Package: flexbar
Version: 1:3.5.0-5
Source Version: 1:3.5.0-5
Distribution: sid
Machine Architecture: arm64
Host Architecture: arm64
Build Architecture: arm64
Build Type: binary
I: No tarballs found in /var/lib/debusine/worker/.cache/sbuild
Unpacking /var/lib/debusine/worker/system-images/1053884/system.tar.xz to /tmp/tmp.sbuild.TUwWqYtloe...
I: NOTICE: Log filtering will replace 'sbuild-unshare-dummy-location' with '<<CHROOT>>'
+------------------------------------------------------------------------------+
| Chroot Setup Commands |
+------------------------------------------------------------------------------+
rm -f /etc/resolv.conf
----------------------
I: Finished running 'rm -f /etc/resolv.conf'.
Finished processing commands.
--------------------------------------------------------------------------------
Copying /tmp/debusine-fetch-exec-upload-wy794es0/seqan-apps-dbgsym_2.5.0~rc3+dfsg-1_arm64.deb to /<<CHROOT>>...
Copying /tmp/debusine-fetch-exec-upload-wy794es0/seqan-apps_2.5.0~rc3+dfsg-1_arm64.deb to /<<CHROOT>>...
Copying /tmp/debusine-fetch-exec-upload-wy794es0/libseqan2-dev_2.5.0~rc3+dfsg-1_all.deb to /<<CHROOT>>...
I: NOTICE: Log filtering will replace 'build/flexbar-sYI1OO/resolver-yKZ5sl' with '<<RESOLVERDIR>>'
+------------------------------------------------------------------------------+
| Update chroot |
+------------------------------------------------------------------------------+
Get:1 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ InRelease
Ign:1 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ InRelease
Get:2 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ Release [606 B]
Get:2 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ Release [606 B]
Get:3 http://deb.debian.org/debian sid InRelease [202 kB]
Get:4 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ Release.gpg
Ign:4 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ Release.gpg
Get:5 file:/build/flexbar-sYI1OO/resolver-nACiTk/apt_archive ./ Packages [4687 B]
Get:6 http://deb.debian.org/debian sid/main arm64 Packages [9958 kB]
Get:7 http://deb.debian.org/debian sid/main arm64 Components [4913 kB]
Fetched 15.1 MB in 2s (6349 kB/s)
Reading package lists...
Reading package lists...
Building dependency tree...
Reading state information...
Calculating upgrade...
The following packages will be upgraded:
apt base-files libapt-pkg6.0t64 libxml-sax-perl
4 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
Need to get 2411 kB of archives.
After this operation, 206 kB of additional disk space will be used.
Get:1 http://deb.debian.org/debian sid/main arm64 base-files arm64 13.6 [72.9 kB]
Get:2 http://deb.debian.org/debian sid/main arm64 libapt-pkg6.0t64 arm64 2.9.14 [969 kB]
Get:3 http://deb.debian.org/debian sid/main arm64 apt arm64 2.9.14 [1316 kB]
Get:4 http://deb.debian.org/debian sid/main arm64 libxml-sax-perl all 1.02+dfsg-4 [53.4 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 2411 kB in 0s (31.2 MB/s)
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 17119 files and directories currently installed.)
Preparing to unpack .../base-files_13.6_arm64.deb ...
Unpacking base-files (13.6) over (13.5) ...
Setting up base-files (13.6) ...
Updating /root/.profile to current default.
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 17119 files and directories currently installed.)
Preparing to unpack .../libapt-pkg6.0t64_2.9.14_arm64.deb ...
Unpacking libapt-pkg6.0t64:arm64 (2.9.14) over (2.9.12) ...
Setting up libapt-pkg6.0t64:arm64 (2.9.14) ...
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 17119 files and directories currently installed.)
Preparing to unpack .../archives/apt_2.9.14_arm64.deb ...
Unpacking apt (2.9.14) over (2.9.12) ...
Setting up apt (2.9.14) ...
(Reading database ...
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 17119 files and directories currently installed.)
Preparing to unpack .../libxml-sax-perl_1.02+dfsg-4_all.deb ...
Unpacking libxml-sax-perl (1.02+dfsg-4) over (1.02+dfsg-3) ...
Setting up libxml-sax-perl (1.02+dfsg-4) ...
update-perl-sax-parsers: Registering Perl SAX parser XML::SAX::PurePerl with priority 10...
update-perl-sax-parsers: Updating overall Perl SAX parser modules info file...
Processing triggers for man-db (2.13.0-1) ...
Processing triggers for libc-bin (2.40-3) ...
+------------------------------------------------------------------------------+
| Fetch source files |
+------------------------------------------------------------------------------+
Local sources
-------------
/tmp/debusine-fetch-exec-upload-wy794es0/flexbar_3.5.0-5.dsc exists in /tmp/debusine-fetch-exec-upload-wy794es0; copying to chroot
I: NOTICE: Log filtering will replace 'build/flexbar-sYI1OO/flexbar-3.5.0' with '<<PKGBUILDDIR>>'
I: NOTICE: Log filtering will replace 'build/flexbar-sYI1OO' with '<<BUILDDIR>>'
+------------------------------------------------------------------------------+
| Install package build dependencies |
+------------------------------------------------------------------------------+
Setup apt archive
-----------------
Merged Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev, build-essential, fakeroot
Filtered Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev, build-essential, fakeroot
dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<<RESOLVERDIR>>/apt_archive/sbuild-build-depends-main-dummy.deb'.
Ign:1 copy:/<<RESOLVERDIR>>/apt_archive ./ InRelease
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ Release [609 B]
Ign:3 copy:/<<RESOLVERDIR>>/apt_archive ./ Release.gpg
Get:4 copy:/<<RESOLVERDIR>>/apt_archive ./ Sources [675 B]
Get:5 copy:/<<RESOLVERDIR>>/apt_archive ./ Packages [707 B]
Fetched 1991 B in 0s (130 kB/s)
Reading package lists...
Ign:1 file:/<<BUILDDIR>>/resolver-nACiTk/apt_archive ./ InRelease
Get:2 file:/<<BUILDDIR>>/resolver-nACiTk/apt_archive ./ Release [606 B]
Get:2 file:/<<BUILDDIR>>/resolver-nACiTk/apt_archive ./ Release [606 B]
Ign:3 file:/<<BUILDDIR>>/resolver-nACiTk/apt_archive ./ Release.gpg
Reading package lists...
Reading package lists...
Install main build dependencies (apt-based resolver)
----------------------------------------------------
Installing build dependencies
Reading package lists...
Building dependency tree...
Reading state information...
The following additional packages will be installed:
autoconf automake autopoint autotools-dev build-essential cmake cmake-data
cpp cpp-14 cpp-14-aarch64-linux-gnu cpp-aarch64-linux-gnu debhelper
dh-autoreconf dh-strip-nondeterminism dwz fakeroot g++ g++-14
g++-14-aarch64-linux-gnu g++-aarch64-linux-gnu gcc gcc-14
gcc-14-aarch64-linux-gnu gcc-aarch64-linux-gnu libarchive13t64 libasan8
libbz2-dev libc-dev-bin libc6-dev libcc1-0 libcrypt-dev libcurl4t64
libdebhelper-perl libelf1t64 libexpat1 libfakeroot
libfile-stripnondeterminism-perl libgcc-14-dev libhwasan0 libhwloc15
libisl23 libitm1 libjsoncpp26 liblsan0 libmpc3 libmpfr6 libncursesw6
libproc2-0 librhash1 libseqan2-dev libstdc++-14-dev libtbb-dev libtbb12
libtbbbind-2-5 libtbbmalloc2 libtool libtsan2 libubsan1 libuv1t64
linux-libc-dev m4 po-debconf procps rpcsvc-proto zlib1g-dev
Suggested packages:
autoconf-archive gnu-standards autoconf-doc cmake-doc cmake-format
elpa-cmake-mode ninja-build cpp-doc gcc-14-locales cpp-14-doc dh-make
gcc-14-doc gcc-multilib manpages-dev flex bison gdb gcc-doc
gdb-aarch64-linux-gnu lrzip libc-devtools glibc-doc libstdc++-14-doc
libtbb-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc
libmail-box-perl
Recommended packages:
bzip2-doc manpages manpages-dev libarchive-cpio-perl libhwloc-plugins
libgpm2 libltdl-dev libmail-sendmail-perl psmisc linux-sysctl-defaults
The following NEW packages will be installed:
autoconf automake autopoint autotools-dev build-essential cmake cmake-data
cpp cpp-14 cpp-14-aarch64-linux-gnu cpp-aarch64-linux-gnu debhelper
dh-autoreconf dh-strip-nondeterminism dwz fakeroot g++ g++-14
g++-14-aarch64-linux-gnu g++-aarch64-linux-gnu gcc gcc-14
gcc-14-aarch64-linux-gnu gcc-aarch64-linux-gnu libarchive13t64 libasan8
libbz2-dev libc-dev-bin libc6-dev libcc1-0 libcrypt-dev libcurl4t64
libdebhelper-perl libelf1t64 libexpat1 libfakeroot
libfile-stripnondeterminism-perl libgcc-14-dev libhwasan0 libhwloc15
libisl23 libitm1 libjsoncpp26 liblsan0 libmpc3 libmpfr6 libncursesw6
libproc2-0 librhash1 libseqan2-dev libstdc++-14-dev libtbb-dev libtbb12
libtbbbind-2-5 libtbbmalloc2 libtool libtsan2 libubsan1 libuv1t64
linux-libc-dev m4 po-debconf procps rpcsvc-proto
sbuild-build-depends-main-dummy zlib1g-dev
0 upgraded, 66 newly installed, 0 to remove and 0 not upgraded.
Need to get 76.6 MB/77.9 MB of archives.
After this operation, 310 MB of additional disk space will be used.
Get:1 file:/<<BUILDDIR>>/resolver-nACiTk/apt_archive ./ libseqan2-dev 2.5.0~rc3+dfsg-1 [1222 kB]
Get:2 copy:/<<RESOLVERDIR>>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [916 B]
Get:3 http://deb.debian.org/debian sid/main arm64 libncursesw6 arm64 6.5-2+b1 [125 kB]
Get:4 http://deb.debian.org/debian sid/main arm64 libproc2-0 arm64 2:4.0.4-6 [62.3 kB]
Get:5 http://deb.debian.org/debian sid/main arm64 procps arm64 2:4.0.4-6 [872 kB]
Get:6 http://deb.debian.org/debian sid/main arm64 m4 arm64 1.4.19-4 [277 kB]
Get:7 http://deb.debian.org/debian sid/main arm64 autoconf all 2.72-3 [493 kB]
Get:8 http://deb.debian.org/debian sid/main arm64 autotools-dev all 20220109.1 [51.6 kB]
Get:9 http://deb.debian.org/debian sid/main arm64 automake all 1:1.16.5-1.3 [823 kB]
Get:10 http://deb.debian.org/debian sid/main arm64 autopoint all 0.22.5-2 [723 kB]
Get:11 http://deb.debian.org/debian sid/main arm64 libc-dev-bin arm64 2.40-3 [50.9 kB]
Get:12 http://deb.debian.org/debian sid/main arm64 linux-libc-dev all 6.11.9-1 [2459 kB]
Get:13 http://deb.debian.org/debian sid/main arm64 libcrypt-dev arm64 1:4.4.36-5 [122 kB]
Get:14 http://deb.debian.org/debian sid/main arm64 rpcsvc-proto arm64 1.4.3-1+b1 [60.5 kB]
Get:15 http://deb.debian.org/debian sid/main arm64 libc6-dev arm64 2.40-3 [1591 kB]
Get:16 http://deb.debian.org/debian sid/main arm64 libisl23 arm64 0.27-1 [601 kB]
Get:17 http://deb.debian.org/debian sid/main arm64 libmpfr6 arm64 4.2.1-1+b2 [680 kB]
Get:18 http://deb.debian.org/debian sid/main arm64 libmpc3 arm64 1.3.1-1+b3 [50.5 kB]
Get:19 http://deb.debian.org/debian sid/main arm64 cpp-14-aarch64-linux-gnu arm64 14.2.0-8 [9166 kB]
Get:20 http://deb.debian.org/debian sid/main arm64 cpp-14 arm64 14.2.0-8 [1284 B]
Get:21 http://deb.debian.org/debian sid/main arm64 cpp-aarch64-linux-gnu arm64 4:14.2.0-1 [4832 B]
Get:22 http://deb.debian.org/debian sid/main arm64 cpp arm64 4:14.2.0-1 [1568 B]
Get:23 http://deb.debian.org/debian sid/main arm64 libcc1-0 arm64 14.2.0-8 [42.2 kB]
Get:24 http://deb.debian.org/debian sid/main arm64 libitm1 arm64 14.2.0-8 [24.2 kB]
Get:25 http://deb.debian.org/debian sid/main arm64 libasan8 arm64 14.2.0-8 [2579 kB]
Get:26 http://deb.debian.org/debian sid/main arm64 liblsan0 arm64 14.2.0-8 [1161 kB]
Get:27 http://deb.debian.org/debian sid/main arm64 libtsan2 arm64 14.2.0-8 [2386 kB]
Get:28 http://deb.debian.org/debian sid/main arm64 libubsan1 arm64 14.2.0-8 [1039 kB]
Get:29 http://deb.debian.org/debian sid/main arm64 libhwasan0 arm64 14.2.0-8 [1442 kB]
Get:30 http://deb.debian.org/debian sid/main arm64 libgcc-14-dev arm64 14.2.0-8 [2365 kB]
Get:31 http://deb.debian.org/debian sid/main arm64 gcc-14-aarch64-linux-gnu arm64 14.2.0-8 [17.7 MB]
Get:32 http://deb.debian.org/debian sid/main arm64 gcc-14 arm64 14.2.0-8 [519 kB]
Get:33 http://deb.debian.org/debian sid/main arm64 gcc-aarch64-linux-gnu arm64 4:14.2.0-1 [1440 B]
Get:34 http://deb.debian.org/debian sid/main arm64 gcc arm64 4:14.2.0-1 [5136 B]
Get:35 http://deb.debian.org/debian sid/main arm64 libstdc++-14-dev arm64 14.2.0-8 [2267 kB]
Get:36 http://deb.debian.org/debian sid/main arm64 g++-14-aarch64-linux-gnu arm64 14.2.0-8 [10.1 MB]
Get:37 http://deb.debian.org/debian sid/main arm64 g++-14 arm64 14.2.0-8 [20.2 kB]
Get:38 http://deb.debian.org/debian sid/main arm64 g++-aarch64-linux-gnu arm64 4:14.2.0-1 [1200 B]
Get:39 http://deb.debian.org/debian sid/main arm64 g++ arm64 4:14.2.0-1 [1332 B]
Get:40 http://deb.debian.org/debian sid/main arm64 build-essential arm64 12.12 [4624 B]
Get:41 http://deb.debian.org/debian sid/main arm64 cmake-data all 3.31.1-1 [2267 kB]
Get:42 http://deb.debian.org/debian sid/main arm64 libarchive13t64 arm64 3.7.4-1.1 [323 kB]
Get:43 http://deb.debian.org/debian sid/main arm64 libcurl4t64 arm64 8.11.0-1 [322 kB]
Get:44 http://deb.debian.org/debian sid/main arm64 libexpat1 arm64 2.6.4-1 [90.7 kB]
Get:45 http://deb.debian.org/debian sid/main arm64 libjsoncpp26 arm64 1.9.6-3 [72.9 kB]
Get:46 http://deb.debian.org/debian sid/main arm64 librhash1 arm64 1.4.5-1 [129 kB]
Get:47 http://deb.debian.org/debian sid/main arm64 libuv1t64 arm64 1.48.0-7 [143 kB]
Get:48 http://deb.debian.org/debian sid/main arm64 cmake arm64 3.31.1-1 [9873 kB]
Get:49 http://deb.debian.org/debian sid/main arm64 libdebhelper-perl all 13.20 [89.7 kB]
Get:50 http://deb.debian.org/debian sid/main arm64 libtool all 2.4.7-8 [517 kB]
Get:51 http://deb.debian.org/debian sid/main arm64 dh-autoreconf all 20 [17.1 kB]
Get:52 http://deb.debian.org/debian sid/main arm64 libfile-stripnondeterminism-perl all 1.14.0-1 [19.5 kB]
Get:53 http://deb.debian.org/debian sid/main arm64 dh-strip-nondeterminism all 1.14.0-1 [8448 B]
Get:54 http://deb.debian.org/debian sid/main arm64 libelf1t64 arm64 0.192-4 [189 kB]
Get:55 http://deb.debian.org/debian sid/main arm64 dwz arm64 0.15-1+b1 [102 kB]
Get:56 http://deb.debian.org/debian sid/main arm64 po-debconf all 1.0.21+nmu1 [248 kB]
Get:57 http://deb.debian.org/debian sid/main arm64 debhelper all 13.20 [915 kB]
Get:58 http://deb.debian.org/debian sid/main arm64 libfakeroot arm64 1.36-1 [29.1 kB]
Get:59 http://deb.debian.org/debian sid/main arm64 fakeroot arm64 1.36-1 [74.4 kB]
Get:60 http://deb.debian.org/debian sid/main arm64 libbz2-dev arm64 1.0.8-6 [31.9 kB]
Get:61 http://deb.debian.org/debian sid/main arm64 libhwloc15 arm64 2.11.2-1 [141 kB]
Get:62 http://deb.debian.org/debian sid/main arm64 libtbbmalloc2 arm64 2021.12.0-1 [35.2 kB]
Get:63 http://deb.debian.org/debian sid/main arm64 libtbbbind-2-5 arm64 2021.12.0-1 [14.1 kB]
Get:64 http://deb.debian.org/debian sid/main arm64 libtbb12 arm64 2021.12.0-1 [63.5 kB]
Get:65 http://deb.debian.org/debian sid/main arm64 libtbb-dev arm64 2021.12.0-1 [193 kB]
Get:66 http://deb.debian.org/debian sid/main arm64 zlib1g-dev arm64 1:1.3.dfsg+really1.3.1-1+b1 [917 kB]
debconf: delaying package configuration, since apt-utils is not installed
Fetched 76.6 MB in 1s (94.9 MB/s)
Selecting previously unselected package libncursesw6:arm64.
(Reading database ... 17119 files and directories currently installed.)
Preparing to unpack .../00-libncursesw6_6.5-2+b1_arm64.deb ...
Unpacking libncursesw6:arm64 (6.5-2+b1) ...
Selecting previously unselected package libproc2-0:arm64.
Preparing to unpack .../01-libproc2-0_2%3a4.0.4-6_arm64.deb ...
Unpacking libproc2-0:arm64 (2:4.0.4-6) ...
Selecting previously unselected package procps.
Preparing to unpack .../02-procps_2%3a4.0.4-6_arm64.deb ...
Unpacking procps (2:4.0.4-6) ...
Selecting previously unselected package m4.
Preparing to unpack .../03-m4_1.4.19-4_arm64.deb ...
Unpacking m4 (1.4.19-4) ...
Selecting previously unselected package autoconf.
Preparing to unpack .../04-autoconf_2.72-3_all.deb ...
Unpacking autoconf (2.72-3) ...
Selecting previously unselected package autotools-dev.
Preparing to unpack .../05-autotools-dev_20220109.1_all.deb ...
Unpacking autotools-dev (20220109.1) ...
Selecting previously unselected package automake.
Preparing to unpack .../06-automake_1%3a1.16.5-1.3_all.deb ...
Unpacking automake (1:1.16.5-1.3) ...
Selecting previously unselected package autopoint.
Preparing to unpack .../07-autopoint_0.22.5-2_all.deb ...
Unpacking autopoint (0.22.5-2) ...
Selecting previously unselected package libc-dev-bin.
Preparing to unpack .../08-libc-dev-bin_2.40-3_arm64.deb ...
Unpacking libc-dev-bin (2.40-3) ...
Selecting previously unselected package linux-libc-dev.
Preparing to unpack .../09-linux-libc-dev_6.11.9-1_all.deb ...
Unpacking linux-libc-dev (6.11.9-1) ...
Selecting previously unselected package libcrypt-dev:arm64.
Preparing to unpack .../10-libcrypt-dev_1%3a4.4.36-5_arm64.deb ...
Unpacking libcrypt-dev:arm64 (1:4.4.36-5) ...
Selecting previously unselected package rpcsvc-proto.
Preparing to unpack .../11-rpcsvc-proto_1.4.3-1+b1_arm64.deb ...
Unpacking rpcsvc-proto (1.4.3-1+b1) ...
Selecting previously unselected package libc6-dev:arm64.
Preparing to unpack .../12-libc6-dev_2.40-3_arm64.deb ...
Unpacking libc6-dev:arm64 (2.40-3) ...
Selecting previously unselected package libisl23:arm64.
Preparing to unpack .../13-libisl23_0.27-1_arm64.deb ...
Unpacking libisl23:arm64 (0.27-1) ...
Selecting previously unselected package libmpfr6:arm64.
Preparing to unpack .../14-libmpfr6_4.2.1-1+b2_arm64.deb ...
Unpacking libmpfr6:arm64 (4.2.1-1+b2) ...
Selecting previously unselected package libmpc3:arm64.
Preparing to unpack .../15-libmpc3_1.3.1-1+b3_arm64.deb ...
Unpacking libmpc3:arm64 (1.3.1-1+b3) ...
Selecting previously unselected package cpp-14-aarch64-linux-gnu.
Preparing to unpack .../16-cpp-14-aarch64-linux-gnu_14.2.0-8_arm64.deb ...
Unpacking cpp-14-aarch64-linux-gnu (14.2.0-8) ...
Selecting previously unselected package cpp-14.
Preparing to unpack .../17-cpp-14_14.2.0-8_arm64.deb ...
Unpacking cpp-14 (14.2.0-8) ...
Selecting previously unselected package cpp-aarch64-linux-gnu.
Preparing to unpack .../18-cpp-aarch64-linux-gnu_4%3a14.2.0-1_arm64.deb ...
Unpacking cpp-aarch64-linux-gnu (4:14.2.0-1) ...
Selecting previously unselected package cpp.
Preparing to unpack .../19-cpp_4%3a14.2.0-1_arm64.deb ...
Unpacking cpp (4:14.2.0-1) ...
Selecting previously unselected package libcc1-0:arm64.
Preparing to unpack .../20-libcc1-0_14.2.0-8_arm64.deb ...
Unpacking libcc1-0:arm64 (14.2.0-8) ...
Selecting previously unselected package libitm1:arm64.
Preparing to unpack .../21-libitm1_14.2.0-8_arm64.deb ...
Unpacking libitm1:arm64 (14.2.0-8) ...
Selecting previously unselected package libasan8:arm64.
Preparing to unpack .../22-libasan8_14.2.0-8_arm64.deb ...
Unpacking libasan8:arm64 (14.2.0-8) ...
Selecting previously unselected package liblsan0:arm64.
Preparing to unpack .../23-liblsan0_14.2.0-8_arm64.deb ...
Unpacking liblsan0:arm64 (14.2.0-8) ...
Selecting previously unselected package libtsan2:arm64.
Preparing to unpack .../24-libtsan2_14.2.0-8_arm64.deb ...
Unpacking libtsan2:arm64 (14.2.0-8) ...
Selecting previously unselected package libubsan1:arm64.
Preparing to unpack .../25-libubsan1_14.2.0-8_arm64.deb ...
Unpacking libubsan1:arm64 (14.2.0-8) ...
Selecting previously unselected package libhwasan0:arm64.
Preparing to unpack .../26-libhwasan0_14.2.0-8_arm64.deb ...
Unpacking libhwasan0:arm64 (14.2.0-8) ...
Selecting previously unselected package libgcc-14-dev:arm64.
Preparing to unpack .../27-libgcc-14-dev_14.2.0-8_arm64.deb ...
Unpacking libgcc-14-dev:arm64 (14.2.0-8) ...
Selecting previously unselected package gcc-14-aarch64-linux-gnu.
Preparing to unpack .../28-gcc-14-aarch64-linux-gnu_14.2.0-8_arm64.deb ...
Unpacking gcc-14-aarch64-linux-gnu (14.2.0-8) ...
Selecting previously unselected package gcc-14.
Preparing to unpack .../29-gcc-14_14.2.0-8_arm64.deb ...
Unpacking gcc-14 (14.2.0-8) ...
Selecting previously unselected package gcc-aarch64-linux-gnu.
Preparing to unpack .../30-gcc-aarch64-linux-gnu_4%3a14.2.0-1_arm64.deb ...
Unpacking gcc-aarch64-linux-gnu (4:14.2.0-1) ...
Selecting previously unselected package gcc.
Preparing to unpack .../31-gcc_4%3a14.2.0-1_arm64.deb ...
Unpacking gcc (4:14.2.0-1) ...
Selecting previously unselected package libstdc++-14-dev:arm64.
Preparing to unpack .../32-libstdc++-14-dev_14.2.0-8_arm64.deb ...
Unpacking libstdc++-14-dev:arm64 (14.2.0-8) ...
Selecting previously unselected package g++-14-aarch64-linux-gnu.
Preparing to unpack .../33-g++-14-aarch64-linux-gnu_14.2.0-8_arm64.deb ...
Unpacking g++-14-aarch64-linux-gnu (14.2.0-8) ...
Selecting previously unselected package g++-14.
Preparing to unpack .../34-g++-14_14.2.0-8_arm64.deb ...
Unpacking g++-14 (14.2.0-8) ...
Selecting previously unselected package g++-aarch64-linux-gnu.
Preparing to unpack .../35-g++-aarch64-linux-gnu_4%3a14.2.0-1_arm64.deb ...
Unpacking g++-aarch64-linux-gnu (4:14.2.0-1) ...
Selecting previously unselected package g++.
Preparing to unpack .../36-g++_4%3a14.2.0-1_arm64.deb ...
Unpacking g++ (4:14.2.0-1) ...
Selecting previously unselected package build-essential.
Preparing to unpack .../37-build-essential_12.12_arm64.deb ...
Unpacking build-essential (12.12) ...
Selecting previously unselected package cmake-data.
Preparing to unpack .../38-cmake-data_3.31.1-1_all.deb ...
Unpacking cmake-data (3.31.1-1) ...
Selecting previously unselected package libarchive13t64:arm64.
Preparing to unpack .../39-libarchive13t64_3.7.4-1.1_arm64.deb ...
Unpacking libarchive13t64:arm64 (3.7.4-1.1) ...
Selecting previously unselected package libcurl4t64:arm64.
Preparing to unpack .../40-libcurl4t64_8.11.0-1_arm64.deb ...
Unpacking libcurl4t64:arm64 (8.11.0-1) ...
Selecting previously unselected package libexpat1:arm64.
Preparing to unpack .../41-libexpat1_2.6.4-1_arm64.deb ...
Unpacking libexpat1:arm64 (2.6.4-1) ...
Selecting previously unselected package libjsoncpp26:arm64.
Preparing to unpack .../42-libjsoncpp26_1.9.6-3_arm64.deb ...
Unpacking libjsoncpp26:arm64 (1.9.6-3) ...
Selecting previously unselected package librhash1:arm64.
Preparing to unpack .../43-librhash1_1.4.5-1_arm64.deb ...
Unpacking librhash1:arm64 (1.4.5-1) ...
Selecting previously unselected package libuv1t64:arm64.
Preparing to unpack .../44-libuv1t64_1.48.0-7_arm64.deb ...
Unpacking libuv1t64:arm64 (1.48.0-7) ...
Selecting previously unselected package cmake.
Preparing to unpack .../45-cmake_3.31.1-1_arm64.deb ...
Unpacking cmake (3.31.1-1) ...
Selecting previously unselected package libdebhelper-perl.
Preparing to unpack .../46-libdebhelper-perl_13.20_all.deb ...
Unpacking libdebhelper-perl (13.20) ...
Selecting previously unselected package libtool.
Preparing to unpack .../47-libtool_2.4.7-8_all.deb ...
Unpacking libtool (2.4.7-8) ...
Selecting previously unselected package dh-autoreconf.
Preparing to unpack .../48-dh-autoreconf_20_all.deb ...
Unpacking dh-autoreconf (20) ...
Selecting previously unselected package libfile-stripnondeterminism-perl.
Preparing to unpack .../49-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ...
Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ...
Selecting previously unselected package dh-strip-nondeterminism.
Preparing to unpack .../50-dh-strip-nondeterminism_1.14.0-1_all.deb ...
Unpacking dh-strip-nondeterminism (1.14.0-1) ...
Selecting previously unselected package libelf1t64:arm64.
Preparing to unpack .../51-libelf1t64_0.192-4_arm64.deb ...
Unpacking libelf1t64:arm64 (0.192-4) ...
Selecting previously unselected package dwz.
Preparing to unpack .../52-dwz_0.15-1+b1_arm64.deb ...
Unpacking dwz (0.15-1+b1) ...
Selecting previously unselected package po-debconf.
Preparing to unpack .../53-po-debconf_1.0.21+nmu1_all.deb ...
Unpacking po-debconf (1.0.21+nmu1) ...
Selecting previously unselected package debhelper.
Preparing to unpack .../54-debhelper_13.20_all.deb ...
Unpacking debhelper (13.20) ...
Selecting previously unselected package libfakeroot:arm64.
Preparing to unpack .../55-libfakeroot_1.36-1_arm64.deb ...
Unpacking libfakeroot:arm64 (1.36-1) ...
Selecting previously unselected package fakeroot.
Preparing to unpack .../56-fakeroot_1.36-1_arm64.deb ...
Unpacking fakeroot (1.36-1) ...
Selecting previously unselected package libbz2-dev:arm64.
Preparing to unpack .../57-libbz2-dev_1.0.8-6_arm64.deb ...
Unpacking libbz2-dev:arm64 (1.0.8-6) ...
Selecting previously unselected package libhwloc15:arm64.
Preparing to unpack .../58-libhwloc15_2.11.2-1_arm64.deb ...
Unpacking libhwloc15:arm64 (2.11.2-1) ...
Selecting previously unselected package libseqan2-dev.
Preparing to unpack .../59-libseqan2-dev_2.5.0~rc3+dfsg-1_all.deb ...
Unpacking libseqan2-dev (2.5.0~rc3+dfsg-1) ...
Selecting previously unselected package libtbbmalloc2:arm64.
Preparing to unpack .../60-libtbbmalloc2_2021.12.0-1_arm64.deb ...
Unpacking libtbbmalloc2:arm64 (2021.12.0-1) ...
Selecting previously unselected package libtbbbind-2-5:arm64.
Preparing to unpack .../61-libtbbbind-2-5_2021.12.0-1_arm64.deb ...
Unpacking libtbbbind-2-5:arm64 (2021.12.0-1) ...
Selecting previously unselected package libtbb12:arm64.
Preparing to unpack .../62-libtbb12_2021.12.0-1_arm64.deb ...
Unpacking libtbb12:arm64 (2021.12.0-1) ...
Selecting previously unselected package libtbb-dev:arm64.
Preparing to unpack .../63-libtbb-dev_2021.12.0-1_arm64.deb ...
Unpacking libtbb-dev:arm64 (2021.12.0-1) ...
Selecting previously unselected package zlib1g-dev:arm64.
Preparing to unpack .../64-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-1+b1_arm64.deb ...
Unpacking zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ...
Selecting previously unselected package sbuild-build-depends-main-dummy.
Preparing to unpack .../65-sbuild-build-depends-main-dummy_0.invalid.0_arm64.deb ...
Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ...
Setting up libexpat1:arm64 (2.6.4-1) ...
Setting up libfile-stripnondeterminism-perl (1.14.0-1) ...
Setting up libtbbmalloc2:arm64 (2021.12.0-1) ...
Setting up libcurl4t64:arm64 (8.11.0-1) ...
Setting up po-debconf (1.0.21+nmu1) ...
Setting up libdebhelper-perl (13.20) ...
Setting up libuv1t64:arm64 (1.48.0-7) ...
Setting up linux-libc-dev (6.11.9-1) ...
Setting up m4 (1.4.19-4) ...
Setting up libfakeroot:arm64 (1.36-1) ...
Setting up libelf1t64:arm64 (0.192-4) ...
Setting up libseqan2-dev (2.5.0~rc3+dfsg-1) ...
Setting up fakeroot (1.36-1) ...
update-alternatives: using /usr/bin/fakeroot-sysv to provide /usr/bin/fakeroot (fakeroot) in auto mode
Setting up autotools-dev (20220109.1) ...
Setting up rpcsvc-proto (1.4.3-1+b1) ...
Setting up libmpfr6:arm64 (4.2.1-1+b2) ...
Setting up libjsoncpp26:arm64 (1.9.6-3) ...
Setting up libproc2-0:arm64 (2:4.0.4-6) ...
Setting up libhwloc15:arm64 (2.11.2-1) ...
Setting up libmpc3:arm64 (1.3.1-1+b3) ...
Setting up autopoint (0.22.5-2) ...
Setting up libncursesw6:arm64 (6.5-2+b1) ...
Setting up autoconf (2.72-3) ...
Setting up libubsan1:arm64 (14.2.0-8) ...
Setting up dh-strip-nondeterminism (1.14.0-1) ...
Setting up dwz (0.15-1+b1) ...
Setting up libhwasan0:arm64 (14.2.0-8) ...
Setting up libcrypt-dev:arm64 (1:4.4.36-5) ...
Setting up libasan8:arm64 (14.2.0-8) ...
Setting up procps (2:4.0.4-6) ...
Setting up cmake-data (3.31.1-1) ...
Setting up librhash1:arm64 (1.4.5-1) ...
Setting up libtsan2:arm64 (14.2.0-8) ...
Setting up libisl23:arm64 (0.27-1) ...
Setting up libc-dev-bin (2.40-3) ...
Setting up libarchive13t64:arm64 (3.7.4-1.1) ...
Setting up libcc1-0:arm64 (14.2.0-8) ...
Setting up liblsan0:arm64 (14.2.0-8) ...
Setting up libitm1:arm64 (14.2.0-8) ...
Setting up automake (1:1.16.5-1.3) ...
update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
Setting up libtbbbind-2-5:arm64 (2021.12.0-1) ...
Setting up cpp-14-aarch64-linux-gnu (14.2.0-8) ...
Setting up cmake (3.31.1-1) ...
Setting up libc6-dev:arm64 (2.40-3) ...
Setting up libgcc-14-dev:arm64 (14.2.0-8) ...
Setting up libstdc++-14-dev:arm64 (14.2.0-8) ...
Setting up libbz2-dev:arm64 (1.0.8-6) ...
Setting up libtbb12:arm64 (2021.12.0-1) ...
Setting up cpp-aarch64-linux-gnu (4:14.2.0-1) ...
Setting up cpp-14 (14.2.0-8) ...
Setting up zlib1g-dev:arm64 (1:1.3.dfsg+really1.3.1-1+b1) ...
Setting up cpp (4:14.2.0-1) ...
Setting up gcc-14-aarch64-linux-gnu (14.2.0-8) ...
Setting up libtbb-dev:arm64 (2021.12.0-1) ...
Setting up gcc-aarch64-linux-gnu (4:14.2.0-1) ...
Setting up g++-14-aarch64-linux-gnu (14.2.0-8) ...
Setting up gcc-14 (14.2.0-8) ...
Setting up g++-aarch64-linux-gnu (4:14.2.0-1) ...
Setting up g++-14 (14.2.0-8) ...
Setting up libtool (2.4.7-8) ...
Setting up gcc (4:14.2.0-1) ...
Setting up dh-autoreconf (20) ...
Setting up g++ (4:14.2.0-1) ...
update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode
Setting up build-essential (12.12) ...
Setting up debhelper (13.20) ...
Setting up sbuild-build-depends-main-dummy (0.invalid.0) ...
Processing triggers for man-db (2.13.0-1) ...
Processing triggers for libc-bin (2.40-3) ...
+------------------------------------------------------------------------------+
| Check architectures |
+------------------------------------------------------------------------------+
Arch check ok (arm64 included in any)
+------------------------------------------------------------------------------+
| Build environment |
+------------------------------------------------------------------------------+
Kernel: Linux 6.1.0-27-cloud-arm64 #1 SMP Debian 6.1.115-1 (2024-11-01) arm64 (aarch64)
Toolchain package versions: binutils_2.43.1-5 dpkg-dev_1.22.11 g++-14_14.2.0-8 gcc-14_14.2.0-8 libc6-dev_2.40-3 libstdc++-14-dev_14.2.0-8 libstdc++6_14.2.0-8 linux-libc-dev_6.11.9-1
Package versions: appstream_1.0.3-1+b1 apt_2.9.14 autoconf_2.72-3 automake_1:1.16.5-1.3 autopoint_0.22.5-2 autotools-dev_20220109.1 base-files_13.6 base-passwd_3.6.5 bash_5.2.32-1+b2 binutils_2.43.1-5 binutils-aarch64-linux-gnu_2.43.1-5 binutils-common_2.43.1-5 bsdextrautils_2.40.2-11 bsdutils_1:2.40.2-11 build-essential_12.12 bzip2_1.0.8-6 ca-certificates_20240203 cmake_3.31.1-1 cmake-data_3.31.1-1 coreutils_9.5-1+b1 cpp_4:14.2.0-1 cpp-14_14.2.0-8 cpp-14-aarch64-linux-gnu_14.2.0-8 cpp-aarch64-linux-gnu_4:14.2.0-1 dash_0.5.12-9+b1 debconf_1.5.87 debhelper_13.20 debian-archive-keyring_2023.4 debianutils_5.21 dh-autoreconf_20 dh-strip-nondeterminism_1.14.0-1 diffstat_1.67-1 diffutils_1:3.10-1+b1 dpkg_1.22.11 dpkg-dev_1.22.11 dwz_0.15-1+b1 e2fsprogs_1.47.1-1+b1 fakeroot_1.36-1 file_1:5.45-3+b1 findutils_4.10.0-3 g++_4:14.2.0-1 g++-14_14.2.0-8 g++-14-aarch64-linux-gnu_14.2.0-8 g++-aarch64-linux-gnu_4:14.2.0-1 gcc_4:14.2.0-1 gcc-14_14.2.0-8 gcc-14-aarch64-linux-gnu_14.2.0-8 gcc-14-base_14.2.0-8 gcc-aarch64-linux-gnu_4:14.2.0-1 gettext_0.22.5-2 gettext-base_0.22.5-2 gpg_2.2.45-2 gpgconf_2.2.45-2 gpgv_2.2.45-2 grep_3.11-4+b1 groff-base_1.23.0-5 gzip_1.12-1.1+b1 hostname_3.25 init-system-helpers_1.67 intltool-debian_0.35.0+20060710.6 iso-codes_4.17.0-1 libacl1_2.3.2-2+b1 libaliased-perl_0.34-3 libappstream5_1.0.3-1+b1 libapt-pkg-perl_0.1.40+b6 libapt-pkg6.0t64_2.9.14 libarchive-zip-perl_1.68-1 libarchive13t64_3.7.4-1.1 libasan8_14.2.0-8 libassuan9_3.0.1-2 libatomic1_14.2.0-8 libattr1_1:2.5.2-2 libaudit-common_1:4.0.2-2 libaudit1_1:4.0.2-2 libb-hooks-endofscope-perl_0.28-1 libb-hooks-op-check-perl_0.22-3+b2 libberkeleydb-perl_0.66-1 libbinutils_2.43.1-5 libblkid1_2.40.2-11 libbrotli1_1.1.0-2+b6 libbsd0_0.12.2-2 libbz2-1.0_1.0.8-6 libbz2-dev_1.0.8-6 libc-bin_2.40-3 libc-dev-bin_2.40-3 libc6_2.40-3 libc6-dev_2.40-3 libcap-ng0_0.8.5-3+b1 libcap2_1:2.66-5+b1 libcapture-tiny-perl_0.48-2 libcc1-0_14.2.0-8 libcgi-pm-perl_4.66-1 libclass-data-inheritable-perl_0.10-1 libclass-inspector-perl_1.36-3 libclass-method-modifiers-perl_2.15-1 libclass-xsaccessor-perl_1.19-4+b4 libclone-perl_0.47-1+b1 libcom-err2_1.47.1-1+b1 libconfig-tiny-perl_2.30-1 libconst-fast-perl_0.014-2 libcpanel-json-xs-perl_4.38-1+b1 libcrypt-dev_1:4.4.36-5 libcrypt1_1:4.4.36-5 libctf-nobfd0_2.43.1-5 libctf0_2.43.1-5 libcurl3t64-gnutls_8.11.0-1 libcurl4t64_8.11.0-1 libdata-dpath-perl_0.60-1 libdata-messagepack-perl_1.02-1+b4 libdata-optlist-perl_0.114-1 libdata-validate-domain-perl_0.15-1 libdata-validate-ip-perl_0.31-1 libdata-validate-uri-perl_0.07-3 libdb5.3t64_5.3.28+dfsg2-9 libdebconfclient0_0.273 libdebhelper-perl_13.20 libdevel-callchecker-perl_0.009-1+b1 libdevel-size-perl_0.84-1+b1 libdevel-stacktrace-perl_2.0500-1 libdpkg-perl_1.22.11 libdynaloader-functions-perl_0.004-1 libelf1t64_0.192-4 libemail-address-xs-perl_1.05-1+b4 libencode-locale-perl_1.05-3 libexception-class-perl_1.45-1 libexpat1_2.6.4-1 libext2fs2t64_1.47.1-1+b1 libfakeroot_1.36-1 libffi8_3.4.6-1 libfile-basedir-perl_0.09-2 libfile-find-rule-perl_0.34-3 libfile-listing-perl_6.16-1 libfile-sharedir-perl_1.118-3 libfile-stripnondeterminism-perl_1.14.0-1 libfont-ttf-perl_1.06-2 libgcc-14-dev_14.2.0-8 libgcc-s1_14.2.0-8 libgcrypt20_1.11.0-6 libgdbm-compat4t64_1.24-2 libgdbm6t64_1.24-2 libglib2.0-0t64_2.82.2-3 libgmp10_2:6.3.0+dfsg-2+b2 libgnutls30t64_3.8.8-2 libgomp1_14.2.0-8 libgpg-error0_1.50-4 libgprofng0_2.43.1-5 libgssapi-krb5-2_1.21.3-3 libhogweed6t64_3.10-1+b1 libhtml-form-perl_6.12-1 libhtml-html5-entities-perl_0.004-3 libhtml-parser-perl_3.83-1+b1 libhtml-tagset-perl_3.24-1 libhtml-tokeparser-simple-perl_3.16-4 libhtml-tree-perl_5.07-3 libhttp-cookies-perl_6.11-1 libhttp-date-perl_6.06-1 libhttp-message-perl_7.00-2 libhttp-negotiate-perl_6.01-2 libhwasan0_14.2.0-8 libhwloc15_2.11.2-1 libicu72_72.1-5+b1 libidn2-0_2.3.7-2+b1 libimport-into-perl_1.002005-2 libio-html-perl_1.004-3 libio-interactive-perl_1.025-1 libio-socket-ssl-perl_2.089-1 libio-string-perl_1.08-4 libipc-run3-perl_0.049-1 libipc-system-simple-perl_1.30-2 libisl23_0.27-1 libiterator-perl_0.03+ds1-2 libiterator-util-perl_0.02+ds1-2 libitm1_14.2.0-8 libjansson4_2.14-2+b3 libjson-maybexs-perl_1.004008-1 libjsoncpp26_1.9.6-3 libk5crypto3_1.21.3-3 libkeyutils1_1.6.3-4 libkrb5-3_1.21.3-3 libkrb5support0_1.21.3-3 libldap-2.5-0_2.5.18+dfsg-3+b1 liblist-compare-perl_0.55-2 liblist-someutils-perl_0.59-1 liblist-utilsby-perl_0.12-2 liblsan0_14.2.0-8 liblwp-mediatypes-perl_6.04-2 liblwp-protocol-https-perl_6.14-1 liblz1_1.15~pre2-1 liblz4-1_1.9.4-3+b1 liblzma5_5.6.3-1+b1 liblzo2-2_2.10-3+b1 libmagic-mgc_1:5.45-3+b1 libmagic1t64_1:5.45-3+b1 libmarkdown2_2.2.7-2.1 libmd0_1.1.0-2+b1 libmldbm-perl_2.05-4 libmodule-implementation-perl_0.09-2 libmodule-runtime-perl_0.016-2 libmoo-perl_2.005005-1 libmoox-aliases-perl_0.001006-2 libmount1_2.40.2-11 libmouse-perl_2.5.11-1+b1 libmpc3_1.3.1-1+b3 libmpfr6_4.2.1-1+b2 libnamespace-clean-perl_0.27-2 libncursesw6_6.5-2+b1 libnet-domain-tld-perl_1.75-4 libnet-http-perl_6.23-1 libnet-ipv6addr-perl_1.02-1 libnet-netmask-perl_2.0002-2 libnet-ssleay-perl_1.94-2 libnetaddr-ip-perl_4.079+dfsg-2+b4 libnettle8t64_3.10-1+b1 libnghttp2-14_1.64.0-1 libnghttp3-9_1.4.0-1+b1 libngtcp2-16_1.6.0-1 libngtcp2-crypto-gnutls8_1.6.0-1 libnumber-compare-perl_0.03-3 libp11-kit0_0.25.5-2+b1 libpackage-stash-perl_0.40-1 libpam-modules_1.5.3-7+b1 libpam-modules-bin_1.5.3-7+b1 libpam-runtime_1.5.3-7 libpam0g_1.5.3-7+b1 libparams-classify-perl_0.015-2+b4 libparams-util-perl_1.102-3+b1 libpath-tiny-perl_0.146-1 libpcre2-8-0_10.44-4 libperl5.40_5.40.0-7 libperlio-gzip-perl_0.20-1+b4 libperlio-utf8-strict-perl_0.010-1+b3 libpipeline1_1.5.8-1 libproc-processtable-perl_0.636-1+b3 libproc2-0_2:4.0.4-6 libpsl5t64_0.21.2-1.1+b1 libreadline8t64_8.2-5 libregexp-wildcards-perl_1.05-3 librhash1_1.4.5-1 librole-tiny-perl_2.002004-1 librtmp1_2.4+20151223.gitfa8646d.1-2+b5 libsasl2-2_2.1.28+dfsg1-8 libsasl2-modules-db_2.1.28+dfsg1-8 libseccomp2_2.5.5-1+b3 libselinux1_3.7-3+b1 libsemanage-common_3.7-2 libsemanage2_3.7-2+b1 libsepol2_3.7-1 libseqan2-dev_2.5.0~rc3+dfsg-1 libsereal-decoder-perl_5.004+ds-1+b3 libsereal-encoder-perl_5.004+ds-1+b3 libsframe1_2.43.1-5 libsmartcols1_2.40.2-11 libsort-versions-perl_1.62-3 libsqlite3-0_3.46.1-1 libss2_1.47.1-1+b1 libssh2-1t64_1.11.1-1 libssl3t64_3.3.2-2 libstdc++-14-dev_14.2.0-8 libstdc++6_14.2.0-8 libstemmer0d_2.2.0-4+b2 libstrictures-perl_2.000006-1 libsub-exporter-perl_0.990-1 libsub-exporter-progressive-perl_0.001013-3 libsub-identify-perl_0.14-3+b3 libsub-install-perl_0.929-1 libsub-name-perl_0.27-1+b3 libsub-quote-perl_2.006008-1 libsyntax-keyword-try-perl_0.30-1+b1 libsystemd0_257~rc2-3 libtasn1-6_4.19.0-3+b3 libtbb-dev_2021.12.0-1 libtbb12_2021.12.0-1 libtbbbind-2-5_2021.12.0-1 libtbbmalloc2_2021.12.0-1 libterm-readkey-perl_2.38-2+b4 libtext-glob-perl_0.11-3 libtext-levenshteinxs-perl_0.03-5+b4 libtext-markdown-discount-perl_0.16-1+b3 libtext-xslate-perl_3.5.9-2+b1 libtime-duration-perl_1.21-2 libtime-moment-perl_0.44-2+b4 libtimedate-perl_2.3300-2 libtinfo6_6.5-2+b1 libtool_2.4.7-8 libtry-tiny-perl_0.32-1 libtsan2_14.2.0-8 libubsan1_14.2.0-8 libuchardet0_0.0.8-1+b2 libudev1_257~rc2-3 libunicode-utf8-perl_0.62-2+b3 libunistring5_1.2-1+b1 liburi-perl_5.30-1 libuuid1_2.40.2-11 libuv1t64_1.48.0-7 libvariable-magic-perl_0.64-1+b1 libwww-mechanize-perl_2.19-1 libwww-perl_6.77-1 libwww-robotrules-perl_6.02-1 libxml-libxml-perl_2.0207+dfsg+really+2.0134-5+b1 libxml-namespacesupport-perl_1.12-2 libxml-sax-base-perl_1.09-3 libxml-sax-perl_1.02+dfsg-4 libxml2_2.12.7+dfsg+really2.9.14-0.2+b1 libxmlb2_0.3.21-1 libxs-parse-keyword-perl_0.46-1+b1 libxxhash0_0.8.2-2+b2 libyaml-0-2_0.2.5-1+b2 libyaml-libyaml-perl_0.902.0+ds-2+b1 libzstd1_1.5.6+dfsg-1+b1 lintian_2.120.0 linux-libc-dev_6.11.9-1 login_1:4.16.0-2+really2.40.2-11 login.defs_1:4.16.0-5 logsave_1.47.1-1+b1 lzop_1.04-2+b1 m4_1.4.19-4 make_4.3-4.1+b1 man-db_2.13.0-1 mawk_1.3.4.20240905-1 mount_2.40.2-11 ncurses-base_6.5-2 ncurses-bin_6.5-2+b1 netbase_6.4 openssl_3.3.2-2 openssl-provider-legacy_3.3.2-2 passwd_1:4.16.0-5 patch_2.7.6-7+b1 patchutils_0.4.2-1+b1 perl_5.40.0-7 perl-base_5.40.0-7 perl-modules-5.40_5.40.0-7 perl-openssl-defaults_7+b2 plzip_1.11-2 po-debconf_1.0.21+nmu1 procps_2:4.0.4-6 readline-common_8.2-5 rpcsvc-proto_1.4.3-1+b1 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2+b1 sensible-utils_0.0.24 shared-mime-info_2.4-5+b1 sysvinit-utils_3.11-1 t1utils_1.41-4+b1 tar_1.35+dfsg-3+b1 tzdata_2024b-3 ucf_3.0043+nmu1 unzip_6.0-28+b1 util-linux_2.40.2-11 xz-utils_5.6.3-1+b1 zlib1g_1:1.3.dfsg+really1.3.1-1+b1 zlib1g-dev_1:1.3.dfsg+really1.3.1-1+b1
+------------------------------------------------------------------------------+
| Build |
+------------------------------------------------------------------------------+
Unpack source
-------------
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA512
Format: 3.0 (quilt)
Source: flexbar
Binary: flexbar
Architecture: any
Version: 1:3.5.0-5
Maintainer: Debian Med Packaging Team <debian-med-packaging@lists.alioth.debian.org>
Uploaders: Andreas Tille <tille@debian.org>, Tony Travis <ajt@minke.ukfsn.org>
Homepage: https://github.com/seqan/flexbar
Standards-Version: 4.6.2
Vcs-Browser: https://salsa.debian.org/med-team/flexbar
Vcs-Git: https://salsa.debian.org/med-team/flexbar.git
Testsuite: autopkgtest
Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev
Package-List:
flexbar deb science optional arch=any
Checksums-Sha1:
0c43550b73a08effdd3a7965e916dc9c6b64f8b2 44021 flexbar_3.5.0.orig.tar.gz
045efb9ac3a789f7903dd592234959f5c8865508 11436 flexbar_3.5.0-5.debian.tar.xz
Checksums-Sha256:
656168934b6cb367ee6d4adad0c40506bc107c888d129fe191c6f3f3446a4ac9 44021 flexbar_3.5.0.orig.tar.gz
b718a9bf496bfead917292eee67d085beb2864b750374794f34ff28bcb6e9795 11436 flexbar_3.5.0-5.debian.tar.xz
Files:
0e07bf4afebfd731c4718b401383224a 44021 flexbar_3.5.0.orig.tar.gz
e818565eaed0b2c567aeb296816f803c 11436 flexbar_3.5.0-5.debian.tar.xz
-----BEGIN PGP SIGNATURE-----
iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmPmH8MRHHRpbGxlQGRl
Ymlhbi5vcmcACgkQV4oElNHGRtFJXQ/+PLfezlqwuyZChCZNmHcP2rYrV578PlHF
mBZE2Te7xmjLkklhdrnTUK1hNzczlGUpWZKBgBAe/XMP33UI+CzpYXUZ58ZkF9oK
8JhYem/Psh0u/Xa0uNUDzCbyrcNwqOsmagiSrCB9WubuP1Ee7GpC7k5KhbhIqTMv
rD63/5Oq3uH6mqsJU2xJbn7ZY7pt0rrPxDE9KdpBAmF6dtDH0n2AxBXjIlC2wBSe
+BnXN8oFeNfCFYzIZ3ZcruGX7O34MtsIKcw9iB05MbK39BlAo0zVK6Xoko4aGmqK
zNOtlml40nknXtjM27Iyc9PppOL8mkSB6NAfQo1fKYqLzjlIKgMaJA9H0DwswOpX
Bhuc5Gqbq5Ic+Ucj/Xq5YKKv3WnLOS0s+DScRuDaU6Z3eqABv34aIdeARI29HsbU
+FdnyWMdhiq4O15LUSlYqLLwC4EofhXwUGYkcznjTWlxB6oAgr5Kr2FAeyB5UrON
Qn15hTMV5IIfGIizOkTC56PF+38wpiXQv4rq3WjzVoGo7hEoMguAufj4C1P1MGiy
uoCQqjrtBEKFuvoYo43nwKZCzzsGNdf7ujIhLNiklUAfmEoeYQPqjQAZOaBtWREo
BHFfpIWb5pitFT0dHD5Wgc0H5t5i68RjfbpEpDqakCqQHcmgNJtXsV+LY6fFgqj8
hssF4XLod0A=
=IhAG
-----END PGP SIGNATURE-----
gpgv: Signature made Fri Feb 10 10:43:15 2023 UTC
gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
gpgv: issuer "tille@debian.org"
gpgv: Can't check signature: No public key
dpkg-source: warning: cannot verify inline signature for ./flexbar_3.5.0-5.dsc: no acceptable signature found
dpkg-source: info: extracting flexbar in /<<PKGBUILDDIR>>
dpkg-source: info: unpacking flexbar_3.5.0.orig.tar.gz
dpkg-source: info: unpacking flexbar_3.5.0-5.debian.tar.xz
dpkg-source: info: using patch list from debian/patches/series
dpkg-source: info: applying no_march_native.patch
dpkg-source: info: applying 195a1ab2c2715b07df5acff58dc2a0396d9cd52d.patch
dpkg-source: info: applying 1c872fa10d474f090633fc95d409aa60607a3f96.patch
dpkg-source: info: applying 19722f2743c96235ff57948eda82f963cf734131.patch
dpkg-source: info: applying a9b0eb87a391aeaf760f8116dca777749c8b4f96.patch
Check disk space
----------------
Sufficient free space for build
User Environment
----------------
APT_CONFIG=/var/lib/sbuild/apt.conf
HOME=/sbuild-nonexistent
LANG=C.UTF-8
LC_ALL=C.UTF-8
LOGNAME=debusine-worker
PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games
SHELL=/bin/sh
USER=debusine-worker
dpkg-buildpackage
-----------------
Command: dpkg-buildpackage --sanitize-env -us -uc -b -rfakeroot
dpkg-buildpackage: info: source package flexbar
dpkg-buildpackage: info: source version 1:3.5.0-5
dpkg-buildpackage: info: source distribution unstable
dpkg-buildpackage: info: source changed by Andreas Tille <tille@debian.org>
dpkg-source --before-build .
dpkg-buildpackage: info: host architecture arm64
debian/rules clean
dh clean
debian/rules override_dh_auto_clean
make[1]: Entering directory '/<<PKGBUILDDIR>>'
dh_auto_clean
rm -f test/result_*fast[aq] test/result_*.log
make[1]: Leaving directory '/<<PKGBUILDDIR>>'
dh_clean
debian/rules binary
dh binary
dh_update_autotools_config
dh_autoreconf
dh_auto_configure
cd obj-aarch64-linux-gnu && DEB_PYTHON_INSTALL_LAYOUT=deb PKG_CONFIG=/usr/bin/pkg-config cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_INSTALL_LIBDIR=lib/aarch64-linux-gnu ..
CMake Deprecation Warning at CMakeLists.txt:1 (cmake_minimum_required):
Compatibility with CMake < 3.10 will be removed from a future version of
CMake.
Update the VERSION argument <min> value. Or, use the <min>...<max> syntax
to tell CMake that the project requires at least <min> but has been updated
to work with policies introduced by <max> or earlier.
-- The C compiler identification is GNU 14.2.0
-- The CXX compiler identification is GNU 14.2.0
-- Detecting C compiler ABI info
-- Detecting C compiler ABI info - done
-- Check for working C compiler: /usr/bin/cc - skipped
-- Detecting C compile features
-- Detecting C compile features - done
-- Detecting CXX compiler ABI info
-- Detecting CXX compiler ABI info - done
-- Check for working CXX compiler: /usr/bin/c++ - skipped
-- Detecting CXX compile features
-- Detecting CXX compile features - done
CMake Deprecation Warning at src/CMakeLists.txt:1 (cmake_minimum_required):
Compatibility with CMake < 3.10 will be removed from a future version of
CMake.
Update the VERSION argument <min> value. Or, use the <min>...<max> syntax
to tell CMake that the project requires at least <min> but has been updated
to work with policies introduced by <max> or earlier.
-- Performing Test COMPILER_SUPPORTS_CXX14
-- Performing Test COMPILER_SUPPORTS_CXX14 - Success
-- Flexbar 64 bit architecture
-- Found ZLIB: /usr/lib/aarch64-linux-gnu/libz.so (found version "1.3.1")
-- Found BZip2: /usr/lib/aarch64-linux-gnu/libbz2.so (found version "1.0.8")
-- Looking for BZ2_bzCompressInit
-- Looking for BZ2_bzCompressInit - found
-- Configuring done (1.6s)
-- Generating done (0.0s)
CMake Warning:
Manually-specified variables were not used by the project:
CMAKE_EXPORT_NO_PACKAGE_REGISTRY
CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY
CMAKE_INSTALL_LIBDIR
CMAKE_INSTALL_LOCALSTATEDIR
CMAKE_INSTALL_RUNSTATEDIR
CMAKE_INSTALL_SYSCONFDIR
FETCHCONTENT_FULLY_DISCONNECTED
-- Build files have been written to: /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu
dh_auto_build
cd obj-aarch64-linux-gnu && make -j8 "INSTALL=install --strip-program=true" VERBOSE=1
make[1]: Entering directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
/usr/bin/cmake -S/<<PKGBUILDDIR>> -B/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0
/usr/bin/cmake -E cmake_progress_start /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu/CMakeFiles /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu//CMakeFiles/progress.marks
make -f CMakeFiles/Makefile2 all
make[2]: Entering directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
make -f src/CMakeFiles/flexbar.dir/build.make src/CMakeFiles/flexbar.dir/depend
make[3]: Entering directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
cd /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /<<PKGBUILDDIR>> /<<PKGBUILDDIR>>/src /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu/src /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu/src/CMakeFiles/flexbar.dir/DependInfo.cmake "--color="
make[3]: Leaving directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
make -f src/CMakeFiles/flexbar.dir/build.make src/CMakeFiles/flexbar.dir/build
make[3]: Entering directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
[ 50%] Building CXX object src/CMakeFiles/flexbar.dir/Flexbar.cpp.o
cd /<<PKGBUILDDIR>>/obj-aarch64-linux-gnu/src && /usr/bin/c++ -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -I/<<PKGBUILDDIR>>/include -g -O2 -ffile-prefix-map=/<<PKGBUILDDIR>>=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -mbranch-protection=standard -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++14 -MD -MT src/CMakeFiles/flexbar.dir/Flexbar.cpp.o -MF CMakeFiles/flexbar.dir/Flexbar.cpp.o.d -o CMakeFiles/flexbar.dir/Flexbar.cpp.o -c /<<PKGBUILDDIR>>/src/Flexbar.cpp
In file included from /usr/include/seqan/align.h:151,
from /<<PKGBUILDDIR>>/src/Flexbar.h:21,
from /<<PKGBUILDDIR>>/src/Flexbar.cpp:24:
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:364:31: error: ‘is_same_v’ is not a member of ‘std’; did you mean ‘is_same’?
364 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~~~~~~~~
| is_same
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:364:54: error: template argument 1 is invalid
364 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~~~~~~~~~~~~~~
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:364:69: error: expected unqualified-id before ‘>’ token
364 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:375:31: error: ‘is_same_v’ is not a member of ‘std’; did you mean ‘is_same’?
375 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~~~~~~~~
| is_same
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:375:54: error: template argument 1 is invalid
375 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~~~~~~~~~~~~~~
/usr/include/seqan/align/dp_matrix_navigator_score_matrix.h:375:69: error: expected unqualified-id before ‘>’ token
375 | inline std::enable_if_t<!std::is_same_v<TColumnType, DPInitialColumn>>
| ^~
In file included from /<<PKGBUILDDIR>>/src/Flexbar.h:26:
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:96:17: error: ‘seqan’ does not name a type
96 | typedef seqan::Dna5String FSeqStr;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:97:17: error: ‘seqan’ does not name a type
97 | typedef seqan::CharString FString;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:99:17: error: ‘seqan’ does not name a type
99 | typedef seqan::StringSet<FSeqStr> TSeqStrs;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:100:17: error: ‘seqan’ does not name a type
100 | typedef seqan::StringSet<FString> TStrings;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:101:17: error: ‘seqan’ does not name a type
101 | typedef seqan::StringSet<bool> TBools;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:103:25: error: ‘FSeqStr’ was not declared in this scope
103 | typedef SeqRead<FSeqStr, FString> TSeqRead;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:103:34: error: ‘FString’ was not declared in this scope
103 | typedef SeqRead<FSeqStr, FString> TSeqRead;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:103:41: error: template argument 1 is invalid
103 | typedef SeqRead<FSeqStr, FString> TSeqRead;
| ^
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:103:41: error: template argument 2 is invalid
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:104:28: error: ‘FSeqStr’ was not declared in this scope
104 | typedef PairedRead<FSeqStr, FString> TPairedRead;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:104:37: error: ‘FString’ was not declared in this scope
104 | typedef PairedRead<FSeqStr, FString> TPairedRead;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:104:44: error: template argument 1 is invalid
104 | typedef PairedRead<FSeqStr, FString> TPairedRead;
| ^
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:104:44: error: template argument 2 is invalid
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:106:17: error: ‘seqan’ does not name a type
106 | typedef seqan::Align<FSeqStr, seqan::ArrayGaps> TAlign;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:107:17: error: ‘seqan’ does not name a type
107 | typedef seqan::StringSet<TAlign> TAlignSet;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:108:17: error: ‘seqan’ does not name a type
108 | typedef seqan::String<int> TAlignScores;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:111:17: error: ‘TAlignSet’ does not name a type
111 | TAlignSet aset;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:112:17: error: ‘TAlignScores’ does not name a type
112 | TAlignScores ascores;
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:139:17: error: ‘FString’ does not name a type
139 | FString id;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:140:17: error: ‘FSeqStr’ does not name a type
140 | FSeqStr seq;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:154:17: error: ‘FString’ does not name a type
154 | FString id, info;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarTypes.h:155:17: error: ‘FSeqStr’ does not name a type
155 | FSeqStr seq1, seq2, seqc;
| ^~~~~~~
In file included from /<<PKGBUILDDIR>>/src/Options.h:12,
from /<<PKGBUILDDIR>>/src/Flexbar.h:27:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:55:33: error: ‘Tag’ does not name a type
55 | using DatFastaAdaptor = Tag<DatFastaAdaptor_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:58:35: error: ‘FormattedFile’ does not name a type
58 | using DatFastaSeqFileIn = FormattedFile<Fastq, Input, DatFastaAdaptor>;
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:62:35: error: ‘Tag’ does not name a type
62 | using DatFastaSeqFormat = Tag<DatFastaSeqFormat_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:65:38: error: ‘TagList’ does not name a type
65 | using DatFastaSeqInFormats = TagList<DatFastaSeqFormat, SeqInFormats>;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:16: error: ‘FileFormat’ is not a class template
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
In file included from /usr/include/seqan/stream.h:111,
from /usr/include/seqan/score.h:43,
from /usr/include/seqan/graph_align.h:45,
from /usr/include/seqan/align.h:59:
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^~~~~
| seqan2::Fastq
In file included from /usr/include/seqan/seq_io.h:52,
from /<<PKGBUILDDIR>>/src/FlexbarIO.h:11:
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’?
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^~~~~
| seqan2::Input
In file included from /usr/include/seqan/file.h:71,
from /usr/include/seqan/stream.h:62:
/usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here
165 | typedef Tag<Input_> Input;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:55: error: ‘DatFastaAdaptor’ was not declared in this scope; did you mean ‘DatFastaAdaptor_’?
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^~~~~~~~~~~~~~~
| DatFastaAdaptor_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:69:72: error: expected unqualified-id before ‘>’ token
69 | struct FileFormat<FormattedFile<Fastq, Input, DatFastaAdaptor> >{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:16: error: ‘MagicHeader’ is not a class template
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:28: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’?
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^~~~~~~~~~~~~~~~~
| DatFastaSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:71: error: ‘Fasta’ was not declared in this scope; did you mean ‘seqan2::Fasta’?
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^~~~~
| seqan2::Fasta
/usr/include/seqan/seq_io/fasta_fastq.h:52:24: note: ‘seqan2::Fasta’ declared here
52 | typedef Tag<TagFasta_> Fasta;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:79: error: wrong number of template arguments (2, should be 1)
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:48: note: provided for ‘template<class T> struct seqan::MagicHeader’
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:16: error: ‘FileExtensions’ is not a class template
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:31: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’?
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^~~~~~~~~~~~~~~~~
| DatFastaSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:37: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’?
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~
| DatFastaSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:57: error: wrong number of template arguments (2, should be 1)
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:51: note: provided for ‘template<class T> struct seqan::FileExtensions’
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:90:54: error: ‘FormattedFile’ has not been declared
90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastaSeqFormat){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:90:67: error: expected ‘,’ or ‘...’ before ‘<’ token
90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastaSeqFormat){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h: In function ‘void seqan::readRecord(TIdString&, TSeqString&, int)’:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:91:33: error: ‘file’ was not declared in this scope
91 | readRecord(id, seq, file.iter, Fasta()); // Delegate to Fasta parser
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:91:44: error: there are no arguments to ‘Fasta’ that depend on a template parameter, so a declaration of ‘Fasta’ must be available [-fpermissive]
91 | readRecord(id, seq, file.iter, Fasta()); // Delegate to Fasta parser
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:91:44: note: (if you use ‘-fpermissive’, G++ will accept your code, but allowing the use of an undeclared name is deprecated)
/<<PKGBUILDDIR>>/src/FlexbarIO.h: At global scope:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:98:33: error: ‘Tag’ does not name a type
98 | using DatFastqAdaptor = Tag<DatFastqAdaptor_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:101:35: error: ‘FormattedFile’ does not name a type
101 | using DatFastqSeqFileIn = FormattedFile<Fastq, Input, DatFastqAdaptor>;
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:105:35: error: ‘Tag’ does not name a type
105 | using DatFastqSeqFormat = Tag<DatFastqSeqFormat_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:108:38: error: ‘TagList’ does not name a type
108 | using DatFastqSeqInFormats = TagList<DatFastqSeqFormat, SeqInFormats>;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:16: error: ‘FileFormat’ is not a class template
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’?
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^~~~~
| seqan2::Input
/usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here
165 | typedef Tag<Input_> Input;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:55: error: ‘DatFastqAdaptor’ was not declared in this scope; did you mean ‘DatFastqAdaptor_’?
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^~~~~~~~~~~~~~~
| DatFastqAdaptor_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:112:72: error: expected unqualified-id before ‘>’ token
112 | struct FileFormat<FormattedFile<Fastq, Input, DatFastqAdaptor> >{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:118:28: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’?
118 | struct MagicHeader<DatFastqSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^~~~~~~~~~~~~~~~~
| DatFastqSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:118:48: error: wrong number of template arguments (2, should be 1)
118 | struct MagicHeader<DatFastqSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:48: note: provided for ‘template<class T> struct seqan::MagicHeader’
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:118:71: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
118 | struct MagicHeader<DatFastqSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:118:79: error: wrong number of template arguments (2, should be 1)
118 | struct MagicHeader<DatFastqSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:48: note: provided for ‘template<class T> struct seqan::MagicHeader’
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:122:31: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’?
122 | struct FileExtensions<DatFastqSeqFormat, T>{
| ^~~~~~~~~~~~~~~~~
| DatFastqSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:122:51: error: wrong number of template arguments (2, should be 1)
122 | struct FileExtensions<DatFastqSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:51: note: provided for ‘template<class T> struct seqan::FileExtensions’
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:127:37: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’?
127 | char const * FileExtensions<DatFastqSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~
| DatFastqSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:127:57: error: wrong number of template arguments (2, should be 1)
127 | char const * FileExtensions<DatFastqSeqFormat, T>::VALUE[1] = { ".dat" };
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:51: note: provided for ‘template<class T> struct seqan::FileExtensions’
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:127:22: error: redefinition of ‘template<class T> const char* seqan::VALUE [1]’
127 | char const * FileExtensions<DatFastqSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘template<class T> const char* seqan::VALUE [1]<T>’ previously declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:133:72: error: ‘FormattedFile’ has not been declared
133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:133:85: error: expected ‘,’ or ‘...’ before ‘<’ token
133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h: In function ‘void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:134:39: error: ‘file’ was not declared in this scope
134 | readRecord(id, seq, qual, file.iter, Fastq()); // Delegate to Fastq parser
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:134:50: error: there are no arguments to ‘Fastq’ that depend on a template parameter, so a declaration of ‘Fastq’ must be available [-fpermissive]
134 | readRecord(id, seq, qual, file.iter, Fastq()); // Delegate to Fastq parser
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h: At global scope:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:139:54: error: ‘FormattedFile’ has not been declared
139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:139:67: error: expected ‘,’ or ‘...’ before ‘<’ token
139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:139:9: error: redefinition of ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, int)’
139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:90:9: note: ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, int)’ previously declared here
90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastaSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:147:37: error: ‘Tag’ does not name a type
147 | using FlexbarReadsAdaptor = Tag<FlexbarReadsAdaptor_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:150:39: error: ‘FormattedFile’ does not name a type
150 | using FlexbarReadsSeqFileIn = FormattedFile<Fastq, Input, FlexbarReadsAdaptor>;
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:154:39: error: ‘Tag’ does not name a type
154 | using FlexbarReadsSeqFormat = Tag<FlexbarReadsSeqFormat_>;
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:157:42: error: ‘TagList’ does not name a type
157 | using FlexbarReadsSeqInFormats = TagList<FlexbarReadsSeqFormat, DatFastqSeqInFormats>;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:16: error: ‘FileFormat’ is not a class template
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’?
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^~~~~
| seqan2::Input
/usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here
165 | typedef Tag<Input_> Input;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:55: error: ‘FlexbarReadsAdaptor’ was not declared in this scope; did you mean ‘FlexbarReadsAdaptor_’?
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^~~~~~~~~~~~~~~~~~~
| FlexbarReadsAdaptor_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:161:76: error: expected unqualified-id before ‘>’ token
161 | struct FileFormat<FormattedFile<Fastq, Input, FlexbarReadsAdaptor> >{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:167:28: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’?
167 | struct MagicHeader<FlexbarReadsSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:167:52: error: wrong number of template arguments (2, should be 1)
167 | struct MagicHeader<FlexbarReadsSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:48: note: provided for ‘template<class T> struct seqan::MagicHeader’
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:167:75: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
167 | struct MagicHeader<FlexbarReadsSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:167:83: error: wrong number of template arguments (2, should be 1)
167 | struct MagicHeader<FlexbarReadsSeqFormat, T> : public MagicHeader<Fastq, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:75:48: note: provided for ‘template<class T> struct seqan::MagicHeader’
75 | struct MagicHeader<DatFastaSeqFormat, T> : public MagicHeader<Fasta, T>{};
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:171:31: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’?
171 | struct FileExtensions<FlexbarReadsSeqFormat, T>{
| ^~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:171:55: error: wrong number of template arguments (2, should be 1)
171 | struct FileExtensions<FlexbarReadsSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:51: note: provided for ‘template<class T> struct seqan::FileExtensions’
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:176:37: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’?
176 | char const * FileExtensions<FlexbarReadsSeqFormat, T>::VALUE[1] = { ".txt" };
| ^~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:176:61: error: wrong number of template arguments (2, should be 1)
176 | char const * FileExtensions<FlexbarReadsSeqFormat, T>::VALUE[1] = { ".txt" };
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:79:51: note: provided for ‘template<class T> struct seqan::FileExtensions’
79 | struct FileExtensions<DatFastaSeqFormat, T>{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:176:22: error: redefinition of ‘template<class T> const char* seqan::VALUE [1]’
176 | char const * FileExtensions<FlexbarReadsSeqFormat, T>::VALUE[1] = { ".txt" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘template<class T> const char* seqan::VALUE [1]<T>’ previously declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:182:72: error: ‘FormattedFile’ has not been declared
182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:182:85: error: expected ‘,’ or ‘...’ before ‘<’ token
182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:182:9: error: redefinition of ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’
182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:133:9: note: ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’ previously declared here
133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:188:54: error: ‘FormattedFile’ has not been declared
188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:188:67: error: expected ‘,’ or ‘...’ before ‘<’ token
188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:188:9: error: redefinition of ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, int)’
188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, FlexbarReadsSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:90:9: note: ‘template<class TIdString, class TSeqString, class TSpec> void seqan::readRecord(TIdString&, TSeqString&, int)’ previously declared here
90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile<Fastq, Input, TSpec> & file, DatFastaSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:195:40: error: ‘FormattedFile’ does not name a type
195 | using FlexbarReadsSeqFileOut = FormattedFile<Fastq, Output, DatFastqAdaptor>;
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:197:43: error: ‘TagList’ does not name a type
197 | using FlexbarReadsSeqOutFormats = TagList<DatFastqSeqFormat, SeqOutFormats>;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:16: error: ‘FileFormat’ is not a class template
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:48: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’?
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^~~~~~
| seqan2::Output
/usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here
168 | typedef Tag<Output_> Output;
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:56: error: ‘DatFastqAdaptor’ was not declared in this scope; did you mean ‘DatFastqAdaptor_’?
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^~~~~~~~~~~~~~~
| DatFastqAdaptor_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:200:73: error: expected unqualified-id before ‘>’ token
200 | struct FileFormat<FormattedFile<Fastq, Output, DatFastqAdaptor> >{
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:9: error: variable or field ‘writeRecord’ declared void
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:21: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:35: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:42: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’?
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~~~
| seqan2::Output
/usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here
168 | typedef Tag<Output_> Output;
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:55: error: expected primary-expression before ‘>’ token
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:59: error: ‘file’ was not declared in this scope
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:75: error: expected primary-expression before ‘&’ token
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:77: error: ‘id’ was not declared in this scope
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:92: error: expected primary-expression before ‘&’ token
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:94: error: ‘seq’ was not declared in this scope
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:109: error: expected primary-expression before ‘&’ token
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:208:111: error: ‘qual’ was not declared in this scope
208 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq, TIdString & qual){
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:9: error: variable or field ‘writeRecord’ declared void
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:21: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’?
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~~~~~~~~~~~
| seqan2::FormattedFile
/usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here
213 | struct FormattedFile
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:35: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’?
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~~~
| seqan2::Fastq
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:42: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’?
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~~~~
| seqan2::Output
/usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here
168 | typedef Tag<Output_> Output;
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:55: error: expected primary-expression before ‘>’ token
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:59: error: ‘file’ was not declared in this scope
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:75: error: expected primary-expression before ‘&’ token
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:77: error: ‘id’ was not declared in this scope
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:92: error: expected primary-expression before ‘&’ token
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:214:94: error: ‘seq’ was not declared in this scope
214 | writeRecord(FormattedFile<Fastq, Output, TSpec> & file, TIdString & id, TSeqString & seq){
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h: In function ‘void checkFileCompression(std::string)’:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:225:22: error: ‘CharString’ has not been declared in ‘seqan’
225 | using seqan::CharString;
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:226:22: error: ‘suffix’ has not been declared in ‘seqan’
226 | using seqan::suffix;
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:227:22: error: ‘length’ has not been declared in ‘seqan’
227 | using seqan::length;
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:231:12: error: ‘length’ was not declared in this scope; did you mean ‘seqan2::length’?
231 | if(length(path) > 3){
| ^~~~~~
| seqan2::length
In file included from /usr/include/seqan/bam_io.h:62,
from /usr/include/seqan/seq_io/bam_sam.h:39,
from /usr/include/seqan/seq_io.h:55:
/usr/include/seqan/bam_io/bam_tags_dict.h:364:1: note: ‘seqan2::length’ declared here
364 | length(BamTagsDict const & tags)
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:232:17: error: ‘CharString’ was not declared in this scope; did you mean ‘seqan2::CharString’?
232 | CharString ending = suffix(path, length(path) - 3);
| ^~~~~~~~~~
| seqan2::CharString
In file included from /usr/include/seqan/sequence.h:112,
from /<<PKGBUILDDIR>>/src/Flexbar.h:20:
/usr/include/seqan/sequence/sequence_shortcuts.h:55:36: note: ‘seqan2::CharString’ declared here
55 | typedef String<char, Alloc<void> > CharString;
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:234:20: error: ‘ending’ was not declared in this scope
234 | if(ending == ".gz"){
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:245:34: error: ‘suffix’ was not declared in this scope; did you mean ‘seqan2::suffix’?
245 | ending = suffix(path, length(path) - 4);
| ^~~~~~
| seqan2::suffix
In file included from /usr/include/seqan/sequence.h:136:
/usr/include/seqan/sequence/string_set_concat_direct.h:605:1: note: ‘seqan2::suffix’ declared here
605 | suffix(StringSet<TString, Owner<ConcatDirect<TSpec> > > const & me, TPosition pos)
| ^~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h: In function ‘void checkInputType(std::string, flexbar::FileFormat&, bool)’:
/<<PKGBUILDDIR>>/src/FlexbarIO.h:288:24: error: ‘FlexbarReadsSeqFileIn’ is not a member of ‘seqan’; did you mean ‘FlexbarReadsSeqFormat_’?
288 | seqan::FlexbarReadsSeqFileIn seqFileIn;
| ^~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/FlexbarIO.h:290:27: error: ‘seqFileIn’ was not declared in this scope
290 | if(! open(seqFileIn, path.c_str())){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:296:36: error: ‘seqFileIn’ was not declared in this scope
296 | if(! atEnd(seqFileIn)){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:296:30: error: ‘atEnd’ was not declared in this scope; did you mean ‘seqan2::atEnd’?
296 | if(! atEnd(seqFileIn)){
| ^~~~~
| seqan2::atEnd
In file included from /usr/include/seqan/store.h:61,
from /usr/include/seqan/seq_io/fai_index.h:41,
from /usr/include/seqan/seq_io.h:73:
/usr/include/seqan/store/store_annotation.h:623:1: note: ‘seqan2::atEnd’ declared here
623 | atEnd(Iter<TFragmentStore, AnnotationTree<TSpec> > & it)
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:298:33: error: ‘FString’ was not declared in this scope
298 | FString id, seq, qual;
| ^~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:300:44: error: ‘id’ was not declared in this scope
300 | readRecord(id, seq, qual, seqFileIn);
| ^~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:300:48: error: ‘seq’ was not declared in this scope
300 | readRecord(id, seq, qual, seqFileIn);
| ^~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:300:53: error: ‘qual’ was not declared in this scope
300 | readRecord(id, seq, qual, seqFileIn);
| ^~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:300:33: error: ‘readRecord’ was not declared in this scope
300 | readRecord(id, seq, qual, seqFileIn);
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:300:33: note: suggested alternatives:
/usr/include/seqan/seq_io/fai_index.h:438:1: note: ‘seqan2::readRecord’
438 | readRecord(FaiIndexEntry_ & entry, TFwdIterator & reader, CharString & buffer)
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:133:9: note: ‘seqan::readRecord’
133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile<Fastq, Input, TSpec> & file, DatFastqSeqFormat){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:311:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type
311 | catch(seqan::Exception const &e){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:311:39: error: expected ‘)’ before ‘const’
311 | catch(seqan::Exception const &e){
| ~ ^~~~~~
| )
/<<PKGBUILDDIR>>/src/FlexbarIO.h:311:40: error: expected ‘{’ before ‘const’
311 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/FlexbarIO.h:311:48: error: expected initializer before ‘)’ token
311 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/FlexbarIO.h:317:23: error: ‘seqFileIn’ was not declared in this scope
317 | close(seqFileIn);
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h: At global scope:
/<<PKGBUILDDIR>>/src/Options.h:125:49: error: ‘CharString’ in namespace ‘seqan’ does not name a type
125 | const std::string getFlexbarBanner(const seqan::CharString version){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h: In function ‘const std::string getFlexbarBanner(int)’:
/<<PKGBUILDDIR>>/src/Options.h:137:9: error: ‘append’ was not declared in this scope; did you mean ‘seqan2::append’?
137 | append(banner, version);
| ^~~~~~
| seqan2::append
In file included from /usr/include/seqan/arg_parse.h:65,
from /<<PKGBUILDDIR>>/src/Flexbar.h:24:
/usr/include/seqan/arg_parse/tool_doc.h:735:13: note: ‘seqan2::append’ declared here
735 | inline void append(ToolDoc & a, ToolDoc const & b)
| ^~~~~~
/<<PKGBUILDDIR>>/src/Options.h: At global scope:
/<<PKGBUILDDIR>>/src/Options.h:160:6: error: variable or field ‘defineOptions’ declared void
160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){
| ^~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:160:27: error: ‘ArgumentParser’ is not a member of ‘seqan’; did you mean ‘seqan2::ArgumentParser’?
160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){
| ^~~~~~~~~~~~~~
In file included from /usr/include/seqan/arg_parse.h:71:
/usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here
152 | class ArgumentParser
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:160:43: error: ‘parser’ was not declared in this scope; did you mean ‘pause’?
160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){
| ^~~~~~
| pause
/<<PKGBUILDDIR>>/src/Options.h:160:51: error: expected primary-expression before ‘const’
160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:160:78: error: expected primary-expression before ‘const’
160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:429:6: error: variable or field ‘parseCmdLine’ declared void
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:429:26: error: ‘ArgumentParser’ is not a member of ‘seqan’; did you mean ‘seqan2::ArgumentParser’?
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~~~~~~~~~~~~
/usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here
152 | class ArgumentParser
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:429:42: error: ‘parser’ was not declared in this scope; did you mean ‘pause’?
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~~~~
| pause
/<<PKGBUILDDIR>>/src/Options.h:429:62: error: expected primary-expression before ‘version’
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:429:71: error: expected primary-expression before ‘int’
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~
/<<PKGBUILDDIR>>/src/Options.h:429:81: error: expected primary-expression before ‘char’
429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){
| ^~~~
/<<PKGBUILDDIR>>/src/Options.h:500:37: error: ‘seqan::ArgumentParser’ has not been declared
500 | void initOptions(Options &o, seqan::ArgumentParser &parser){
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h: In function ‘void initOptions(Options&, int&)’:
/<<PKGBUILDDIR>>/src/Options.h:505:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
505 | bool stdOutReads = isSet(parser, "stdout-reads");
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:516:17: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’?
516 | getOptionValue(s, parser, "target");
| ^~~~~~~~~~~~~~
| seqan2::getOptionValue
/usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here
704 | inline bool getOptionValue(TValue & val,
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:531:9: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’?
531 | getOptionValue(o.readsFile, parser, "reads");
| ^~~~~~~~~~~~~~
| seqan2::getOptionValue
/usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here
704 | inline bool getOptionValue(TValue & val,
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h: At global scope:
/<<PKGBUILDDIR>>/src/Options.h:536:37: error: ‘seqan::ArgumentParser’ has not been declared
536 | void loadOptions(Options &o, seqan::ArgumentParser &parser){
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h: In function ‘void loadOptions(Options&, int&)’:
/<<PKGBUILDDIR>>/src/Options.h:543:34: error: ‘getVersion’ was not declared in this scope; did you mean ‘seqan2::getVersion’?
543 | *out << getFlexbarBanner(getVersion(parser)) << endl;
| ^~~~~~~~~~
| seqan2::getVersion
In file included from /usr/include/seqan/arg_parse.h:73:
/usr/include/seqan/arg_parse/arg_parse_doc.h:326:27: note: ‘seqan2::getVersion’ declared here
326 | inline CharString const & getVersion(ArgumentParser const & me)
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:551:9: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’?
551 | getOptionValue(o.nThreads, parser, "threads");
| ^~~~~~~~~~~~~~
| seqan2::getOptionValue
/usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here
704 | inline bool getOptionValue(TValue & val,
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Options.h:567:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
567 | if(isSet(parser, "bundles")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:599:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
599 | if(isSet(parser, "interleaved")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:606:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
606 | if(isSet(parser, "reads2")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:627:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
627 | if(isSet(parser, "iupac")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:635:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
635 | if(isSet(parser, "barcodes")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:673:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
673 | if(isSet(parser, "adapters")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:684:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
684 | if(isSet(parser, "adapters2") && o.adapRm == NORMAL && o.isPaired){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:690:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
690 | if(isSet(parser, "adapter-preset")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:725:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
725 | if(isSet(parser, "pre-trim-left")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:730:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
730 | if(isSet(parser, "pre-trim-right")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:735:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
735 | if(isSet(parser, "post-trim-length")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:756:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
756 | if(isSet(parser, "qtrim") && o.format == FASTQ){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:817:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
817 | if(isSet(parser, "htrim-left") || isSet(parser, "htrim-right")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:858:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
858 | if(isSet(parser, "align-log")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:866:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
866 | if(isSet(parser, "zip-output")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:879:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
879 | if(isSet(parser, "single-reads")) o.writeSingleReads = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:881:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
881 | if(isSet(parser, "single-reads-paired")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:888:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
888 | if(isSet(parser, "output-reads") && (isSet(parser, "output-reads2") || o.runType == SINGLE)){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:892:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
892 | if(isSet(parser, "output-reads2") && isSet(parser, "output-reads") && o.runType == PAIRED){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:907:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
907 | if(isSet(parser, "fasta-output")) o.switch2Fasta = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:908:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
908 | if(isSet(parser, "length-dist")) o.writeLengthDist = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:909:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
909 | if(isSet(parser, "number-tags")) o.useNumberTag = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:910:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
910 | if(isSet(parser, "removal-tags")) o.useRemovalTag = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:911:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
911 | if(isSet(parser, "umi-tags")) o.umiTags = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:935:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
935 | if(isSet(parser, "barcode-tail-length")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:940:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
940 | if(isSet(parser, "barcode-min-overlap")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:958:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
958 | if(isSet(parser, "barcode-unassigned")) o.writeUnassigned = true;
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:980:26: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
980 | if(o.isPaired && isSet(parser, "adapter-pair-overlap")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1019:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1019 | if(isSet(parser, "adapter-tail-length")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1024:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1024 | if(isSet(parser, "adapter-revcomp")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1055:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1055 | if(isSet(parser, "adapter-relaxed")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1060:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1060 | if(isSet(parser, "adapter-add-barcode") && o.isPaired && o.a_end == RIGHT && o.rcMode != RCON &&
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1067:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1067 | if(isSet(parser, "adapter-trimmed-out")){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
/<<PKGBUILDDIR>>/src/Options.h:1076:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’?
1076 | if(isSet(parser, "adapter-read-set") && o.isPaired && o.adapRm != NORMAL2){
| ^~~~~
| seqan2::isSet
/usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here
599 | inline bool isSet(ArgumentParser const & me, std::string const & name)
| ^~~~~
In file included from /<<PKGBUILDDIR>>/src/Flexbar.h:29:
/<<PKGBUILDDIR>>/src/LoadFasta.h: In member function ‘void LoadFasta<TSeqStr, TString>::loadSequences(std::string)’:
/<<PKGBUILDDIR>>/src/LoadFasta.h:36:24: error: ‘DatFastaSeqFileIn’ is not a member of ‘seqan’; did you mean ‘DatFastaSeqFormat_’?
36 | seqan::DatFastaSeqFileIn seqFileIn;
| ^~~~~~~~~~~~~~~~~
| DatFastaSeqFormat_
/<<PKGBUILDDIR>>/src/LoadFasta.h:38:27: error: ‘seqFileIn’ was not declared in this scope
38 | if(! open(seqFileIn, filePath.c_str())){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:44:25: error: ‘TSeqStrs’ was not declared in this scope; did you mean ‘TSeqStr’?
44 | TSeqStrs seqs;
| ^~~~~~~~
| TSeqStr
/<<PKGBUILDDIR>>/src/LoadFasta.h:45:25: error: ‘TStrings’ was not declared in this scope; did you mean ‘TString’?
45 | TStrings ids;
| ^~~~~~~~
| TString
/<<PKGBUILDDIR>>/src/LoadFasta.h:47:37: error: ‘ids’ was not declared in this scope
47 | readRecords(ids, seqs, seqFileIn);
| ^~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:47:42: error: ‘seqs’ was not declared in this scope
47 | readRecords(ids, seqs, seqFileIn);
| ^~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:47:48: error: ‘seqFileIn’ was not declared in this scope
47 | readRecords(ids, seqs, seqFileIn);
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:47:25: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-fpermissive]
47 | readRecords(ids, seqs, seqFileIn);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:51:53: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
51 | for(unsigned int i = 0; i < length(ids); ++i){
| ^~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:67:45: error: ‘struct flexbar::TBar’ has no member named ‘id’
67 | bar.id = ids[i];
| ^~
/<<PKGBUILDDIR>>/src/LoadFasta.h:68:45: error: ‘struct flexbar::TBar’ has no member named ‘seq’
68 | bar.seq = seqs[i];
| ^~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:77:48: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
77 | seqan::reverseComplement(seq);
| ^~~~~~~~~~~~~~~~~
In file included from /usr/include/seqan/modifier.h:77,
from /usr/include/seqan/align.h:57:
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:80:47: error: ‘struct flexbar::TBar’ has no member named ‘id’
80 | barRC.id = id;
| ^~
/<<PKGBUILDDIR>>/src/LoadFasta.h:81:47: error: ‘struct flexbar::TBar’ has no member named ‘seq’
81 | barRC.seq = seq;
| ^~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:87:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type
87 | catch(seqan::Exception const &e){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:87:40: error: expected ‘)’ before ‘const’
87 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:87:22: note: to match this ‘(’
87 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/LoadFasta.h:87:40: error: expected ‘{’ before ‘const’
87 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h:87:48: error: expected initializer before ‘)’ token
87 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/LoadFasta.h:93:23: error: ‘seqFileIn’ was not declared in this scope
93 | close(seqFileIn);
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadFasta.h: In member function ‘void LoadFasta<TSeqStr, TString>::printBars(std::string) const’:
/<<PKGBUILDDIR>>/src/LoadFasta.h:121:53: error: ‘const tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘id’
121 | TString seqTag = bars.at(i).id;
| ^~
/<<PKGBUILDDIR>>/src/LoadFasta.h:128:68: error: ‘const tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘seq’
128 | *out << seqTag << whiteSpace << bars.at(i).seq << "\n";
| ^~~
In file included from /<<PKGBUILDDIR>>/src/Flexbar.h:30:
/<<PKGBUILDDIR>>/src/LoadAdapters.h: In constructor ‘LoadAdapters<TSeqStr, TString>::LoadAdapters(const Options&)’:
/<<PKGBUILDDIR>>/src/LoadAdapters.h:35:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
35 | a.id = "TruSeq";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:36:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
36 | a.seq1 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:37:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’
37 | a.seq2 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:38:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
38 | a.info = "TruSeq LT and TruSeq HT-based kits";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:41:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
41 | a.id = "TrueSeq-Methyl";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:42:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
42 | a.seq1 = "AGATCGGAAGAGCACACGTCTGAAC";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:43:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’
43 | a.seq2 = "AGATCGGAAGAGCGTCGTGTAGGGA";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:44:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
44 | a.info = "ScriptSeq and TruSeq DNA Methylation";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:47:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
47 | a.id = "TrueSeq-smallRNA";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:48:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
48 | a.seq1 = "TGGAATTCTCGGGTGCCAAGG";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:49:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
49 | a.info = "TruSeq Small RNA";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:52:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
52 | a.id = "TrueSeq-Ribo";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:53:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
53 | a.seq1 = "AGATCGGAAGAGCACACGTCT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:54:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
54 | a.info = "TruSeq Ribo Profile";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:57:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
57 | a.id = "Nextera-TruSight";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:58:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
58 | a.seq1 = "CTGTCTCTTATACACATCT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:59:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
59 | a.info = "AmpliSeq, Nextera, Nextera DNA Flex, Nextera DNA, Nextera XT, Nextera Enrichment, Nextera Rapid Capture Enrichment, TruSight Enrichment, TruSight Rapid Capture Enrichment, TruSight HLA";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:62:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’
62 | a.id = "Nextera-Matepair";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:63:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
63 | a.seq1 = "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:64:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’
64 | a.seq2 = "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:65:27: error: ‘struct flexbar::Adapters’ has no member named ‘seqc’
65 | a.seqc = "CTGTCTCTTATACACATCT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:66:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’
66 | a.info = "Nextera Mate Pair";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:72:28: error: ‘struct flexbar::Adapters’ has no member named ‘id’
72 | IonTorrent.id = "IonTorrent";
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:73:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
73 | IonTorrent.seq1 = "ATCACCGACTGCCCATAGAGAGGCTGAGAC";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:74:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
74 | IonTorrent.seq1 = "CCATCTCATCCCTGCGTGTCTCCGACTCAG";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:75:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’
75 | IonTorrent.seq2 = "CCTCTCTATGGGCAGTCGGTGAT";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:76:28: error: ‘struct flexbar::Adapters’ has no member named ‘info’
76 | IonTorrent.info = "IonTorrent";
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h: In member function ‘void LoadAdapters<TSeqStr, TString>::loadSequences(bool)’:
/<<PKGBUILDDIR>>/src/LoadAdapters.h:88:32: error: ‘struct flexbar::Adapters’ has no member named ‘id’
88 | TString id = a.id;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:91:41: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’
91 | if(! secondSet) seq = a.seq1;
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:92:41: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’
92 | else seq = a.seq2;
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:96:33: error: ‘struct flexbar::TBar’ has no member named ‘id’
96 | adapter.id = id;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:97:33: error: ‘struct flexbar::TBar’ has no member named ‘seq’
97 | adapter.seq = seq;
| ^~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:106:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
106 | seqan::reverseComplement(seqRC);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:109:35: error: ‘struct flexbar::TBar’ has no member named ‘id’
109 | adapterRC.id = idRC;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:110:35: error: ‘struct flexbar::TBar’ has no member named ‘seq’
110 | adapterRC.seq = seqRC;
| ^~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:117:42: error: ‘struct flexbar::Adapters’ has no member named ‘seqc’
117 | TSeqStr seqc = a.seqc;
| ^~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:122:33: error: ‘struct flexbar::TBar’ has no member named ‘id’
122 | adapter.id = idc;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:123:33: error: ‘struct flexbar::TBar’ has no member named ‘seq’
123 | adapter.seq = seqc;
| ^~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:127:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
127 | seqan::reverseComplement(seqc);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:130:35: error: ‘struct flexbar::TBar’ has no member named ‘id’
130 | adapterRC.id = idc;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:131:35: error: ‘struct flexbar::TBar’ has no member named ‘seq’
131 | adapterRC.seq = seqc;
| ^~~
/<<PKGBUILDDIR>>/src/LoadAdapters.h: In member function ‘void LoadAdapters<TSeqStr, TString>::printAdapters(std::string) const’:
/<<PKGBUILDDIR>>/src/LoadAdapters.h:156:57: error: ‘const tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘id’
156 | TString seqTag = adapters.at(i).id;
| ^~
/<<PKGBUILDDIR>>/src/LoadAdapters.h:163:72: error: ‘const tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘seq’
163 | *out << seqTag << whiteSpace << adapters.at(i).seq << "\n";
| ^~~
In file included from /<<PKGBUILDDIR>>/src/Flexbar.h:31:
/<<PKGBUILDDIR>>/src/SeqInput.h: At global scope:
/<<PKGBUILDDIR>>/src/SeqInput.h:15:16: error: ‘FlexbarReadsSeqFileIn’ in namespace ‘seqan’ does not name a type; did you mean ‘FlexbarReadsSeqFormat_’?
15 | seqan::FlexbarReadsSeqFileIn seqFileIn;
| ^~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/SeqInput.h:64:42: error: ‘seqan::StringSet’ has not been declared
64 | unsigned int loadSeqReads(seqan::StringSet<bool> &uncalled, flexbar::TStrings &ids, flexbar::TSeqStrs &seqs, flexbar::TStrings &quals, const unsigned int nReads){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:64:51: error: expected ‘,’ or ‘...’ before ‘<’ token
64 | unsigned int loadSeqReads(seqan::StringSet<bool> &uncalled, flexbar::TStrings &ids, flexbar::TSeqStrs &seqs, flexbar::TStrings &quals, const unsigned int nReads){
| ^
/<<PKGBUILDDIR>>/src/SeqInput.h: In constructor ‘SeqInput<TSeqStr, TString>::SeqInput(const Options&, std::string, bool, bool)’:
/<<PKGBUILDDIR>>/src/SeqInput.h:45:35: error: ‘seqFileIn’ was not declared in this scope
45 | if(! open(seqFileIn, cin)){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:51:35: error: ‘seqFileIn’ was not declared in this scope
51 | if(! open(seqFileIn, filePath.c_str())){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h: In destructor ‘virtual SeqInput<TSeqStr, TString>::~SeqInput()’:
/<<PKGBUILDDIR>>/src/SeqInput.h:59:23: error: ‘seqFileIn’ was not declared in this scope
59 | close(seqFileIn);
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h: In member function ‘unsigned int SeqInput<TSeqStr, TString>::loadSeqReads(int)’:
/<<PKGBUILDDIR>>/src/SeqInput.h:69:30: error: ‘prefix’ has not been declared in ‘seqan’
69 | using seqan::prefix;
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:70:30: error: ‘suffix’ has not been declared in ‘seqan’
70 | using seqan::suffix;
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:71:30: error: ‘length’ has not been declared in ‘seqan’
71 | using seqan::length;
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:74:36: error: ‘seqFileIn’ was not declared in this scope
74 | if(! atEnd(seqFileIn)){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:74:30: error: there are no arguments to ‘atEnd’ that depend on a template parameter, so a declaration of ‘atEnd’ must be available [-fpermissive]
74 | if(! atEnd(seqFileIn)){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:76:41: error: ‘ids’ was not declared in this scope
76 | reserve(ids, nReads);
| ^~~
/<<PKGBUILDDIR>>/src/SeqInput.h:76:51: error: ‘nReads’ was not declared in this scope; did you mean ‘read’?
76 | reserve(ids, nReads);
| ^~~~~~
| read
/<<PKGBUILDDIR>>/src/SeqInput.h:76:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
76 | reserve(ids, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:77:41: error: ‘seqs’ was not declared in this scope
77 | reserve(seqs, nReads);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:77:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
77 | reserve(seqs, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:78:41: error: ‘uncalled’ was not declared in this scope
78 | reserve(uncalled, nReads);
| ^~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:78:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
78 | reserve(uncalled, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:83:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-fpermissive]
83 | readRecords(ids, seqs, seqFileIn, nReads);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:86:57: error: ‘quals’ was not declared in this scope
86 | reserve(quals, nReads);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:86:49: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
86 | reserve(quals, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:87:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-fpermissive]
87 | readRecords(ids, seqs, quals, seqFileIn, nReads);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:91:48: error: ‘StringSet’ is not a member of ‘seqan’; did you mean ‘seqan2::StringSet’?
91 | seqan::StringSet<seqan::IupacString> seqsIupac;
| ^~~~~~~~~
In file included from /usr/include/seqan/sequence.h:133:
/usr/include/seqan/sequence/sequence_concatenator.h:50:7: note: ‘seqan2::StringSet’ declared here
50 | class StringSet;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:91:65: error: ‘IupacString’ is not a member of ‘seqan’; did you mean ‘seqan2::IupacString’?
91 | seqan::StringSet<seqan::IupacString> seqsIupac;
| ^~~~~~~~~~~
/usr/include/seqan/sequence/sequence_shortcuts.h:215:37: note: ‘seqan2::IupacString’ declared here
215 | typedef String<Iupac, Alloc<void> > IupacString;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:91:78: error: ‘seqsIupac’ was not declared in this scope
91 | seqan::StringSet<seqan::IupacString> seqsIupac;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:93:41: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
93 | reserve(seqsIupac, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:96:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-fpermissive]
96 | readRecords(ids, seqsIupac, seqFileIn, nReads);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:99:57: error: ‘quals’ was not declared in this scope
99 | reserve(quals, nReads);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:99:49: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
99 | reserve(quals, nReads);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:100:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-fpermissive]
100 | readRecords(ids, seqsIupac, quals, seqFileIn, nReads);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:106:61: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
106 | for(unsigned int i = 0; i < length(ids); ++i){
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:136:63: error: ‘quals’ was not declared in this scope
136 | erase(quals[i], 0, idx);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:136:57: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
136 | erase(quals[i], 0, idx);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:147:57: error: ‘quals’ was not declared in this scope
147 | quals[i] = prefix(quals[i], length(quals[i]) - idx);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:147:85: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
147 | quals[i] = prefix(quals[i], length(quals[i]) - idx);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:151:74: error: ‘quals’ was not declared in this scope
151 | if(qualTrim(seq, quals[i], m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:156:46: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
156 | m_nrReads += length(ids);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:158:40: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
158 | return length(ids);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:163:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type
163 | catch(seqan::Exception const &e){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:163:40: error: expected ‘)’ before ‘const’
163 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:163:22: note: to match this ‘(’
163 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/SeqInput.h:163:40: error: expected ‘{’ before ‘const’
163 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:163:48: error: expected initializer before ‘)’ token
163 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/SeqInput.h: In member function ‘bool SeqInput<TSeqStr, TString>::isUncalledSequence(TSeqStr&)’:
/<<PKGBUILDDIR>>/src/SeqInput.h:176:26: error: expected nested-name-specifier before ‘Iterator’
176 | typename Iterator<TSeqStr>::Type it, itEnd;
| ^~~~~~~~
/<<PKGBUILDDIR>>/src/SeqInput.h:176:26: error: expected ‘(’ before ‘Iterator’
/<<PKGBUILDDIR>>/src/SeqInput.h:178:17: error: ‘it’ was not declared in this scope; did you mean ‘int’?
178 | it = begin(seq);
| ^~
| int
/<<PKGBUILDDIR>>/src/SeqInput.h:179:17: error: ‘itEnd’ was not declared in this scope
179 | itEnd = end(seq);
| ^~~~~
In file included from /<<PKGBUILDDIR>>/src/Flexbar.h:32:
/<<PKGBUILDDIR>>/src/PairedInput.h: In member function ‘void* PairedInput<TSeqStr, TString>::loadPairedReadBundle() const’:
/<<PKGBUILDDIR>>/src/PairedInput.h:62:17: error: ‘TSeqStrs’ was not declared in this scope; did you mean ‘TSeqStr’?
62 | TSeqStrs seqs, seqs2, seqsBR;
| ^~~~~~~~
| TSeqStr
/<<PKGBUILDDIR>>/src/PairedInput.h:63:17: error: ‘TStrings’ was not declared in this scope; did you mean ‘TString’?
63 | TStrings ids, ids2, idsBR;
| ^~~~~~~~
| TString
/<<PKGBUILDDIR>>/src/PairedInput.h:64:26: error: expected ‘;’ before ‘quals’
64 | TStrings quals, quals2, qualsBR;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:65:17: error: ‘TBools’ was not declared in this scope; did you mean ‘bool’?
65 | TBools uncalled, uncalled2, uncalledBR;
| ^~~~~~
| bool
/<<PKGBUILDDIR>>/src/PairedInput.h:74:58: error: ‘uncalled’ was not declared in this scope; did you mean ‘m_uncalled’?
74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize);
| ^~~~~~~~
| m_uncalled
/<<PKGBUILDDIR>>/src/PairedInput.h:74:68: error: ‘ids’ was not declared in this scope
74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize);
| ^~~
/<<PKGBUILDDIR>>/src/PairedInput.h:74:73: error: ‘seqs’ was not declared in this scope
74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize);
| ^~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:74:79: error: ‘quals’ was not declared in this scope
74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:82:67: error: ‘uncalled2’ was not declared in this scope; did you mean ‘m_uncalled’?
82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize);
| ^~~~~~~~~
| m_uncalled
/<<PKGBUILDDIR>>/src/PairedInput.h:82:78: error: ‘ids2’ was not declared in this scope
82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize);
| ^~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:82:84: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’?
82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize);
| ^~~~~
| seqan2
/<<PKGBUILDDIR>>/src/PairedInput.h:82:91: error: ‘quals2’ was not declared in this scope
82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:91:68: error: ‘uncalledBR’ was not declared in this scope
91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize);
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:91:80: error: ‘idsBR’ was not declared in this scope
91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:91:87: error: ‘seqsBR’ was not declared in this scope
91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:91:95: error: ‘qualsBR’ was not declared in this scope
91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:113:53: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
113 | for(unsigned int i = 0; i < length(ids); ++i){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:115:66: error: ‘uncalled2’ was not declared in this scope; did you mean ‘m_uncalled’?
115 | if(uncalled[i] || (m_isPaired && uncalled2[i])){
| ^~~~~~~~~
| m_uncalled
/<<PKGBUILDDIR>>/src/PairedInput.h:133:66: error: ‘ids2’ was not declared in this scope
133 | if(m_isPaired) ids2[i] = tagCount;
| ^~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:134:66: error: ‘idsBR’ was not declared in this scope
134 | if(m_useBarRead) idsBR[i] = tagCount;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:141:89: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’?
141 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i]);
| ^~~~~
| seqan2
/<<PKGBUILDDIR>>/src/PairedInput.h:141:100: error: ‘ids2’ was not declared in this scope
141 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i]);
| ^~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:142:89: error: ‘seqsBR’ was not declared in this scope
142 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:142:100: error: ‘idsBR’ was not declared in this scope
142 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:146:89: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’?
146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]);
| ^~~~~
| seqan2
/<<PKGBUILDDIR>>/src/PairedInput.h:146:100: error: ‘ids2’ was not declared in this scope
146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]);
| ^~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:146:110: error: ‘quals2’ was not declared in this scope
146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:147:89: error: ‘seqsBR’ was not declared in this scope
147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:147:100: error: ‘idsBR’ was not declared in this scope
147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:147:110: error: ‘qualsBR’ was not declared in this scope
147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:156:65: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
156 | unsigned int nEntries = (unsigned int) (length(ids) / 2);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:183:66: error: ‘idsBR’ was not declared in this scope
183 | if(m_useBarRead) idsBR[i] = tagCount;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:191:89: error: ‘seqsBR’ was not declared in this scope
191 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:191:100: error: ‘idsBR’ was not declared in this scope
191 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:196:89: error: ‘seqsBR’ was not declared in this scope
196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:196:100: error: ‘idsBR’ was not declared in this scope
196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedInput.h:196:110: error: ‘qualsBR’ was not declared in this scope
196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]);
| ^~~~~~~
In file included from /<<PKGBUILDDIR>>/src/PairedOutput.h:6,
from /<<PKGBUILDDIR>>/src/Flexbar.h:33:
/<<PKGBUILDDIR>>/src/SeqOutput.h: At global scope:
/<<PKGBUILDDIR>>/src/SeqOutput.h:12:16: error: ‘FlexbarReadsSeqFileOut’ in namespace ‘seqan’ does not name a type; did you mean ‘FlexbarReadsSeqFormat_’?
12 | seqan::FlexbarReadsSeqFileOut seqFileOut;
| ^~~~~~~~~~~~~~~~~~~~~~
| FlexbarReadsSeqFormat_
/<<PKGBUILDDIR>>/src/SeqOutput.h: In constructor ‘SeqOutput<TSeqStr, TString>::SeqOutput(const std::string&, TString, bool, const Options&)’:
/<<PKGBUILDDIR>>/src/SeqOutput.h:56:40: error: ‘seqFileOut’ was not declared in this scope
56 | setFormat(seqFileOut, seqan::Fasta());
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:56:59: error: ‘Fasta’ is not a member of ‘seqan’; did you mean ‘seqan2::Fasta’?
56 | setFormat(seqFileOut, seqan::Fasta());
| ^~~~~
/usr/include/seqan/seq_io/fasta_fastq.h:52:24: note: ‘seqan2::Fasta’ declared here
52 | typedef Tag<TagFasta_> Fasta;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:56:30: error: there are no arguments to ‘setFormat’ that depend on a template parameter, so a declaration of ‘setFormat’ must be available [-fpermissive]
56 | setFormat(seqFileOut, seqan::Fasta());
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:57:40: error: ‘seqFileOut’ was not declared in this scope
57 | else setFormat(seqFileOut, seqan::Fastq());
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:57:59: error: ‘Fastq’ is not a member of ‘seqan’; did you mean ‘seqan2::Fastq’?
57 | else setFormat(seqFileOut, seqan::Fastq());
| ^~~~~
/usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here
59 | typedef Tag<TagFastq_> Fastq;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:57:30: error: there are no arguments to ‘setFormat’ that depend on a template parameter, so a declaration of ‘setFormat’ must be available [-fpermissive]
57 | else setFormat(seqFileOut, seqan::Fastq());
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:59:35: error: ‘seqFileOut’ was not declared in this scope
59 | if(! open(seqFileOut, cout)){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:65:35: error: ‘seqFileOut’ was not declared in this scope
65 | if(! open(seqFileOut, m_filePath.c_str())){
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h: In destructor ‘virtual SeqOutput<TSeqStr, TString>::~SeqOutput()’:
/<<PKGBUILDDIR>>/src/SeqOutput.h:74:41: error: ‘seqFileOut’ was not declared in this scope
74 | if(! m_useStdout) close(seqFileOut);
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h: In member function ‘void SeqOutput<TSeqStr, TString>::writeSeqRead(flexbar::TSeqRead&)’:
/<<PKGBUILDDIR>>/src/SeqOutput.h:114:40: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
114 | append(seqRead.id, "_");
| ^~
/<<PKGBUILDDIR>>/src/SeqOutput.h:114:25: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
114 | append(seqRead.id, "_");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:115:40: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
115 | append(seqRead.id, m_tagStr);
| ^~
/<<PKGBUILDDIR>>/src/SeqOutput.h:120:45: error: ‘seqFileOut’ was not declared in this scope
120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq);
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:120:65: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq);
| ^~
/<<PKGBUILDDIR>>/src/SeqOutput.h:120:77: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:120:33: error: there are no arguments to ‘writeRecord’ that depend on a template parameter, so a declaration of ‘writeRecord’ must be available [-fpermissive]
120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:123:45: error: ‘seqFileOut’ was not declared in this scope
123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual);
| ^~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:123:65: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual);
| ^~
/<<PKGBUILDDIR>>/src/SeqOutput.h:123:77: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual);
| ^~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:123:90: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:123:33: error: there are no arguments to ‘writeRecord’ that depend on a template parameter, so a declaration of ‘writeRecord’ must be available [-fpermissive]
123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:126:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type
126 | catch(seqan::Exception const &e){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:126:40: error: expected ‘)’ before ‘const’
126 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:126:22: note: to match this ‘(’
126 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/SeqOutput.h:126:40: error: expected ‘{’ before ‘const’
126 | catch(seqan::Exception const &e){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqOutput.h:126:48: error: expected initializer before ‘)’ token
126 | catch(seqan::Exception const &e){
| ^
/<<PKGBUILDDIR>>/src/PairedOutput.h: In constructor ‘PairedOutput<TSeqStr, TString>::PairedOutput(Options&)’:
/<<PKGBUILDDIR>>/src/PairedOutput.h:88:81: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
88 | TString barcode = m_barcodes->at(idxB1).id;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:92:88: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
92 | append(barcode, m_barcodes2->at(idxB2).id);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:210:77: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
210 | TString barcode = m_barcodes->at(i).id;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h: In member function ‘void PairedOutput<TSeqStr, TString>::writePairedRead(flexbar::TPairedRead*) const’:
/<<PKGBUILDDIR>>/src/PairedOutput.h:250:43: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
250 | if(pRead->r1 != NULL){
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:251:95: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
251 | if(m_runType == SINGLE || m_writeUnassigned || pRead->barID > 0){
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:254:76: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
254 | if(qualTrim(pRead->r1, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:257:66: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
257 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:257:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
257 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true;
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:258:70: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
258 | else m_outMap[pRead->barID].m_nShort_1++;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:260:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
260 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC)) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:260:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
260 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC)) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:261:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
261 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:261:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
261 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:263:74: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
263 | if(r1ok) m_outMap[pRead->barID].f1->writeRead(pRead->r1);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:263:102: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
263 | if(r1ok) m_outMap[pRead->barID].f1->writeRead(pRead->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:272:43: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
272 | if(pRead->r1 != NULL && pRead->r2 != NULL){
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:272:64: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
272 | if(pRead->r1 != NULL && pRead->r2 != NULL){
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:274:61: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
274 | int outIdx = pRead->barID;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:277:74: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
277 | if(outIdx == 0 || pRead->barID2 == 0){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:280:72: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
280 | else outIdx += (pRead->barID2 - 1) * m_barcodes->size();
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:286:76: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
286 | if(qualTrim(pRead->r1, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:287:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
287 | if(qualTrim(pRead->r2, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:290:66: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
290 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:290:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
290 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true;
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:291:66: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
291 | if(length(pRead->r2->seq) >= m_minLength) r2ok = true;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:291:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
291 | if(length(pRead->r2->seq) >= m_minLength) r2ok = true;
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:296:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:296:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:296:144: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:297:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:297:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:297:144: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:299:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:299:116: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:299:144: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:300:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:300:116: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:300:144: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false;
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:303:95: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
303 | m_outMap[outIdx].f1->writeRead(pRead->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:304:95: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
304 | m_outMap[outIdx].f2->writeRead(pRead->r2);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:310:108: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
310 | m_outMap[outIdx].single1->writeRead(pRead->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:314:72: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
314 | pRead->r2->seq = "N";
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:317:72: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
317 | pRead->r2->qual = prefix(pRead->r1->qual, 1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:317:97: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
317 | pRead->r2->qual = prefix(pRead->r1->qual, 1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:317:83: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-fpermissive]
317 | pRead->r2->qual = prefix(pRead->r1->qual, 1);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:319:103: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
319 | m_outMap[outIdx].f1->writeRead(pRead->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:320:103: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
320 | m_outMap[outIdx].f2->writeRead(pRead->r2);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:327:108: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
327 | m_outMap[outIdx].single2->writeRead(pRead->r2);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:331:72: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
331 | pRead->r1->seq = "N";
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:334:72: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
334 | pRead->r1->qual = prefix(pRead->r2->qual, 1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:334:97: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
334 | pRead->r1->qual = prefix(pRead->r2->qual, 1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:334:83: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-fpermissive]
334 | pRead->r1->qual = prefix(pRead->r2->qual, 1);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedOutput.h:336:103: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
336 | m_outMap[outIdx].f1->writeRead(pRead->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h:337:103: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
337 | m_outMap[outIdx].f2->writeRead(pRead->r2);
| ^~
/<<PKGBUILDDIR>>/src/PairedOutput.h: In member function ‘void PairedOutput<TSeqStr, TString>::printAdapterRemovalStats(bool)’:
/<<PKGBUILDDIR>>/src/PairedOutput.h:477:58: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
477 | TString seqTag = adapters->at(i).id;
| ^~
In file included from /<<PKGBUILDDIR>>/src/PairedAlign.h:6,
from /<<PKGBUILDDIR>>/src/Flexbar.h:34:
/<<PKGBUILDDIR>>/src/SeqAlign.h: In member function ‘int SeqAlign<TSeqStr, TString, TAlgorithm>::alignSeqRead(flexbar::TSeqRead*, bool, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int&, const flexbar::AlignmentMode&, flexbar::TrimEnd, const TSeqStr&)’:
/<<PKGBUILDDIR>>/src/SeqAlign.h:62:30: error: ‘prefix’ has not been declared in ‘seqan’
62 | using seqan::prefix;
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:63:30: error: ‘suffix’ has not been declared in ‘seqan’
63 | using seqan::suffix;
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:66:52: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
66 | int readLength = length(seqRead.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:66:37: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
66 | int readLength = length(seqRead.seq);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:78:59: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
78 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize * m_queries->size());
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:78:40: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
78 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize * m_queries->size());
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:85:67: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’
85 | TSeqStr *qseq = &m_queries->at(i).seq;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:86:58: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
86 | TSeqStr *rseq = &seqRead.seq;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:91:71: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’
91 | append(tmpq, m_queries->at(i).seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:99:91: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
99 | if(trimEnd == LTAIL) tmp = prefix(seqRead.seq, tailLength);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:99:76: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-fpermissive]
99 | if(trimEnd == LTAIL) tmp = prefix(seqRead.seq, tailLength);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:100:91: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
100 | else tmp = suffix(seqRead.seq, readLength - tailLength);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:100:76: error: there are no arguments to ‘suffix’ that depend on a template parameter, so a declaration of ‘suffix’ must be available [-fpermissive]
100 | else tmp = suffix(seqRead.seq, readLength - tailLength);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:105:33: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’?
105 | TAlign align;
| ^~~~~~
| SeqAlign
/<<PKGBUILDDIR>>/src/SeqAlign.h:106:56: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
106 | appendValue(alignments.aset, align);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:106:33: error: there are no arguments to ‘appendValue’ that depend on a template parameter, so a declaration of ‘appendValue’ must be available [-fpermissive]
106 | appendValue(alignments.aset, align);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:107:56: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
107 | resize(rows(alignments.aset[idxAl]), 2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:107:40: error: there are no arguments to ‘rows’ that depend on a template parameter, so a declaration of ‘rows’ must be available [-fpermissive]
107 | resize(rows(alignments.aset[idxAl]), 2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:109:61: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
109 | assignSource(row(alignments.aset[idxAl], 0), *rseq);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:109:46: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
109 | assignSource(row(alignments.aset[idxAl], 0), *rseq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:110:61: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
110 | assignSource(row(alignments.aset[idxAl], 1), *qseq);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:110:46: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
110 | assignSource(row(alignments.aset[idxAl], 1), *qseq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:133:65: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’
133 | a.queryLength = length(m_queries->at(i).seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:133:41: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
133 | a.queryLength = length(m_queries->at(i).seq);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:147:74: error: request for member ‘pairOverlap’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
147 | if(! m_isBarcoding && m_poMode == PON && seqRead.pairOverlap &&
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:181:57: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
181 | seqRead.seq = "";
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:182:79: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
182 | if(m_format == FASTQ) seqRead.qual = "";
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:206:63: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
206 | erase(seqRead.seq, 0, rCutPos);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:206:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
206 | erase(seqRead.seq, 0, rCutPos);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:209:63: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
209 | erase(seqRead.qual, 0, rCutPos);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:209:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
209 | erase(seqRead.qual, 0, rCutPos);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:223:63: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
223 | erase(seqRead.seq, rCutPos, readLength);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:223:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
223 | erase(seqRead.seq, rCutPos, readLength);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:226:63: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
226 | erase(seqRead.qual, rCutPos, readLength);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:226:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
226 | erase(seqRead.qual, rCutPos, readLength);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:236:87: error: request for member ‘rmAdapter’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
236 | if(! m_queries->at(qIndex).rcAdapter) seqRead.rmAdapter = true;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:237:87: error: request for member ‘rmAdapterRC’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
237 | else seqRead.rmAdapterRC = true;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:247:56: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
247 | append(seqRead.id, "_Flexbar_removal");
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:247:41: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
247 | append(seqRead.id, "_Flexbar_removal");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:250:64: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
250 | append(seqRead.id, "_");
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:250:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
250 | append(seqRead.id, "_");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:251:64: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
251 | append(seqRead.id, m_queries->at(qIndex).id);
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:251:90: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
251 | append(seqRead.id, m_queries->at(qIndex).id);
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:251:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
251 | append(seqRead.id, m_queries->at(qIndex).id);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:263:48: error: request for member ‘umi’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
263 | append(seqRead.umi, "_");
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:263:33: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
263 | append(seqRead.umi, "_");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:264:48: error: request for member ‘umi’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
264 | append(seqRead.umi, am.umiTag);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:279:85: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
279 | s << " query id " << m_queries->at(qIndex).id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:281:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
281 | << " read id " << seqRead.id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:289:79: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
289 | s << " remaining read " << seqRead.seq << "\n";
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:292:79: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
292 | s << " remaining qual " << seqRead.qual << "\n";
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlign.h:297:46: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
297 | s << seqRead.id << "\t" << m_queries->at(qIndex).id << "\t"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:297:85: error: ‘using tbb::detail::d1::concurrent_vector<flexbar::TBar>::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’
297 | s << seqRead.id << "\t" << m_queries->at(qIndex).id << "\t"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:304:54: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
304 | << "read id " << seqRead.id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlign.h:305:54: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
305 | << "read seq " << seqRead.seq << "\n\n" << endl;
| ^~~
In file included from /<<PKGBUILDDIR>>/src/PairedAlign.h:7:
/<<PKGBUILDDIR>>/src/SeqAlignPair.h: In member function ‘void SeqAlignPair<TSeqStr, TString, TAlgorithm>::alignSeqReadPair(flexbar::TSeqRead*, flexbar::TSeqRead*, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int&)’:
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:60:50: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
60 | int readLength = length(seqRead.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:60:35: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
60 | int readLength = length(seqRead.seq);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:61:51: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
61 | int readLength2 = length(seqRead2.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:61:35: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
61 | int readLength2 = length(seqRead2.seq);
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:73:59: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
73 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:73:40: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-fpermissive]
73 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:75:51: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
75 | TSeqStr rcSeq2 = seqRead2.seq;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:76:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
76 | seqan::reverseComplement(rcSeq2);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:78:25: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’?
78 | TAlign align;
| ^~~~~~
| SeqAlign
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:79:48: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
79 | appendValue(alignments.aset, align);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:79:25: error: there are no arguments to ‘appendValue’ that depend on a template parameter, so a declaration of ‘appendValue’ must be available [-fpermissive]
79 | appendValue(alignments.aset, align);
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:80:48: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
80 | resize(rows(alignments.aset[idxAl]), 2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:80:32: error: there are no arguments to ‘rows’ that depend on a template parameter, so a declaration of ‘rows’ must be available [-fpermissive]
80 | resize(rows(alignments.aset[idxAl]), 2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:82:53: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:82:38: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:82:78: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:83:53: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
83 | assignSource(row(alignments.aset[idxAl], 1), rcSeq2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:83:38: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
83 | assignSource(row(alignments.aset[idxAl], 1), rcSeq2);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:105:42: error: request for member ‘pairOverlap’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
105 | seqRead2.pairOverlap = true;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:110:56: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
110 | erase(seqRead2.seq, rCutPos, readLength2);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:110:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
110 | erase(seqRead2.seq, rCutPos, readLength2);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:113:56: error: request for member ‘qual’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
113 | erase(seqRead2.qual, rCutPos, readLength2);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:113:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
113 | erase(seqRead2.qual, rCutPos, readLength2);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:117:50: error: request for member ‘poRemoval’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
117 | seqRead2.poRemoval = true;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:119:72: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
119 | if(m_writeTag) append(seqRead2.id, "_Flexbar_removal_PO");
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:119:56: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
119 | if(m_writeTag) append(seqRead2.id, "_Flexbar_removal_PO");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:125:41: error: request for member ‘pairOverlap’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
125 | seqRead.pairOverlap = true;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:130:55: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
130 | erase(seqRead.seq, rCutPos, readLength);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:130:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
130 | erase(seqRead.seq, rCutPos, readLength);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:133:55: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
133 | erase(seqRead.qual, rCutPos, readLength);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:133:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
133 | erase(seqRead.qual, rCutPos, readLength);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:137:49: error: request for member ‘poRemoval’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
137 | seqRead.poRemoval = true;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:139:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
139 | if(m_writeTag) append(seqRead.id, "_Flexbar_removal_PO");
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:139:56: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
139 | if(m_writeTag) append(seqRead.id, "_Flexbar_removal_PO");
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:154:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
154 | s << " read id " << seqRead.id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:156:72: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
156 | << " read2 id " << seqRead2.id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:162:71: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
162 | << " remaining read " << seqRead.seq << "\n";
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:165:71: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
165 | s << " remaining qual " << seqRead.qual << "\n";
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:167:72: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
167 | s << " remaining read2 " << seqRead2.seq << "\n";
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:170:72: error: request for member ‘qual’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
170 | s << " remaining qual2 " << seqRead2.qual << "\n";
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:175:46: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
175 | s << seqRead.id << "\t" << seqRead2.id << "\t"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:175:71: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
175 | s << seqRead.id << "\t" << seqRead2.id << "\t"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:182:54: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
182 | << "read id " << seqRead.id << "\n"
| ^~
/<<PKGBUILDDIR>>/src/SeqAlignPair.h:183:55: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
183 | << "read2 id " << seqRead2.id << "\n\n" << endl;
| ^~
In file included from /<<PKGBUILDDIR>>/src/PairedAlign.h:8:
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h: At global scope:
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:12:33: error: ‘Value’ in namespace ‘seqan’ does not name a template type
12 | typedef typename seqan::Value<TSeqStr>::Type TChar;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:12:38: error: expected unqualified-id before ‘<’ token
12 | typedef typename seqan::Value<TSeqStr>::Type TChar;
| ^
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:13:33: error: ‘Row’ in namespace ‘seqan’ does not name a template type
13 | typedef typename seqan::Row<flexbar::TAlign>::Type TRow;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:13:36: error: expected unqualified-id before ‘<’ token
13 | typedef typename seqan::Row<flexbar::TAlign>::Type TRow;
| ^
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:14:33: error: ‘Iterator’ in namespace ‘seqan’ does not name a template type
14 | typedef typename seqan::Iterator<TRow>::Type TRowIterator;
| ^~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:14:41: error: expected unqualified-id before ‘<’ token
14 | typedef typename seqan::Iterator<TRow>::Type TRowIterator;
| ^
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:18:24: error: ‘Score’ in namespace ‘seqan’ does not name a template type
18 | typedef seqan::Score<int, seqan::Simple> TScoreSimple;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:19:24: error: ‘Score’ in namespace ‘seqan’ does not name a template type
19 | typedef seqan::Score<int, seqan::ScoreMatrix<TChar, seqan::Default> > TScoreMatrix;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:22:9: error: ‘TScoreMatrix’ does not name a type
22 | TScoreMatrix m_scoreMatrix;
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:142:31: error: ‘TScoreMatrix’ has not been declared
142 | void printScoreMatrix(TScoreMatrix &scoreMatrix){
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h: In constructor ‘SeqAlignAlgo<TSeqStr>::SeqAlignAlgo(const Options&, int, int, int, bool)’:
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:37:17: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’?
37 | m_scoreMatrix = TScoreMatrix(gapCost);
| ^~~~~~~~~~~~~
| printScoreMatrix
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:37:33: error: there are no arguments to ‘TScoreMatrix’ that depend on a template parameter, so a declaration of ‘TScoreMatrix’ must be available [-fpermissive]
37 | m_scoreMatrix = TScoreMatrix(gapCost);
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:39:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’?
39 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~~~~~
| seqan2::ValueSize
In file included from /usr/include/seqan/basic/basic_fundamental.h:75,
from /usr/include/seqan/basic.h:58,
from /<<PKGBUILDDIR>>/src/Flexbar.h:19:
/usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here
47 | template <typename T> struct ValueSize;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:39:51: error: ‘TChar’ was not declared in this scope
39 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:39:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE<T>’?
39 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~
| seqan::VALUE<T>
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE<T>’ declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:40:67: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE<T>’?
40 | for(unsigned j = 0; j < ValueSize<TChar>::VALUE; ++j){
| ^~~~~
| seqan::VALUE<T>
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE<T>’ declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:43:42: error: there are no arguments to ‘setScore’ that depend on a template parameter, so a declaration of ‘setScore’ must be available [-fpermissive]
43 | setScore(m_scoreMatrix, TChar(i), TChar(j), match);
| ^~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:44:38: error: there are no arguments to ‘setScore’ that depend on a template parameter, so a declaration of ‘setScore’ must be available [-fpermissive]
44 | else setScore(m_scoreMatrix, TChar(i), TChar(j), mismatch);
| ^~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h: In member function ‘void SeqAlignAlgo<TSeqStr>::alignGlobal(TAlignResults&, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int, flexbar::TrimEnd)’:
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:73:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’?
73 | AlignConfig<true, false, true, true> ac;
| ^~~~~~~~~~~
| seqan2::AlignConfig
In file included from /usr/include/seqan/align.h:70:
/usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here
93 | class AlignConfig
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:73:70: error: ‘ac’ was not declared in this scope; did you mean ‘a’?
73 | AlignConfig<true, false, true, true> ac;
| ^~
| a
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:74:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’
74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:74:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:74:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’?
74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~
| printScoreMatrix
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:74:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-fpermissive]
74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:78:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’?
78 | AlignConfig<true, true, false, true> ac;
| ^~~~~~~~~~~
| seqan2::AlignConfig
/usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here
93 | class AlignConfig
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:78:70: error: ‘ac’ was not declared in this scope; did you mean ‘a’?
78 | AlignConfig<true, true, false, true> ac;
| ^~
| a
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:79:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’
79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:79:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:79:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’?
79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~
| printScoreMatrix
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:79:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-fpermissive]
79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:82:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’?
82 | AlignConfig<true, true, true, true> ac;
| ^~~~~~~~~~~
| seqan2::AlignConfig
/usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here
93 | class AlignConfig
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:82:69: error: ‘ac’ was not declared in this scope; did you mean ‘a’?
82 | AlignConfig<true, true, true, true> ac;
| ^~
| a
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:83:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’
83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:83:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:83:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’?
83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~
| printScoreMatrix
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:83:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-fpermissive]
83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac);
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:87:17: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’?
87 | TAlign &align = alignments.aset[idxAl];
| ^~~~~~
| SeqAlign
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:87:44: error: ‘struct flexbar::Alignments’ has no member named ‘aset’
87 | TAlign &align = alignments.aset[idxAl];
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:88:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’
88 | a.score = alignments.ascores[idxAl];
| ^~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:94:17: error: ‘TRow’ was not declared in this scope
94 | TRow &row1 = row(align, 0);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:94:23: error: ‘row1’ was not declared in this scope
94 | TRow &row1 = row(align, 0);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:94:30: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
94 | TRow &row1 = row(align, 0);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:95:23: error: ‘row2’ was not declared in this scope
95 | TRow &row2 = row(align, 1);
| ^~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:95:30: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-fpermissive]
95 | TRow &row2 = row(align, 1);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:97:31: error: there are no arguments to ‘toViewPosition’ that depend on a template parameter, so a declaration of ‘toViewPosition’ must be available [-fpermissive]
97 | a.startPosS = toViewPosition(row1, 0);
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:98:31: error: there are no arguments to ‘toViewPosition’ that depend on a template parameter, so a declaration of ‘toViewPosition’ must be available [-fpermissive]
98 | a.startPosA = toViewPosition(row2, 0);
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:99:59: error: there are no arguments to ‘source’ that depend on a template parameter, so a declaration of ‘source’ must be available [-fpermissive]
99 | a.endPosS = toViewPosition(row1, length(source(row1)));
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:100:59: error: there are no arguments to ‘source’ that depend on a template parameter, so a declaration of ‘source’ must be available [-fpermissive]
100 | a.endPosA = toViewPosition(row2, length(source(row2)));
| ^~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:118:17: error: ‘TRowIterator’ was not declared in this scope
118 | TRowIterator it1 = begin(row1);
| ^~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:119:30: error: expected ‘;’ before ‘it2’
119 | TRowIterator it2 = begin(row2);
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:126:23: error: ‘it1’ was not declared in this scope
126 | for(; it1 != end(row1); ++it1){
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:129:41: error: there are no arguments to ‘isGap’ that depend on a template parameter, so a declaration of ‘isGap’ must be available [-fpermissive]
129 | if(isGap(it1)) ++a.gapsR;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:130:47: error: ‘it2’ was not declared in this scope
130 | else if(isGap(it2)) ++a.gapsA;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:130:41: error: there are no arguments to ‘isGap’ that depend on a template parameter, so a declaration of ‘isGap’ must be available [-fpermissive]
130 | else if(isGap(it2)) ++a.gapsA;
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:132:125: error: ‘TChar’ was not declared in this scope
132 | else if(m_umiTags && *it2 == 'N') append(a.umiTag, (TChar) *it1);
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:135:27: error: ‘it2’ was not declared in this scope
135 | ++it2;
| ^~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h: In member function ‘void SeqAlignAlgo<TSeqStr>::printScoreMatrix(int&)’:
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:148:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’?
148 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i)
| ^~~~~~~~~
| seqan2::ValueSize
/usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here
47 | template <typename T> struct ValueSize;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:148:51: error: ‘TChar’ was not declared in this scope
148 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i)
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:148:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE<T>’?
148 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i)
| ^~~~~
| seqan::VALUE<T>
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE<T>’ declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:152:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’?
152 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~~~~~
| seqan2::ValueSize
/usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here
47 | template <typename T> struct ValueSize;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:152:51: error: ‘TChar’ was not declared in this scope
152 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:152:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE<T>’?
152 | for(unsigned i = 0; i < ValueSize<TChar>::VALUE; ++i){
| ^~~~~
| seqan::VALUE<T>
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE<T>’ declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:154:67: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE<T>’?
154 | for(unsigned j = 0; j < ValueSize<TChar>::VALUE; ++j)
| ^~~~~
| seqan::VALUE<T>
/<<PKGBUILDDIR>>/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE<T>’ declared here
84 | char const * FileExtensions<DatFastaSeqFormat, T>::VALUE[1] = { ".dat" };
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/SeqAlignAlgo.h:155:49: error: there are no arguments to ‘score’ that depend on a template parameter, so a declaration of ‘score’ must be available [-fpermissive]
155 | cout << "\t" << score(scoreMatrix, TChar(i), TChar(j));
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h: In member function ‘void PairedAlign<TSeqStr, TString>::alignPairedReadToBarcodes(flexbar::TPairedRead*, flexbar::TAlignBundle&, std::vector<flexbar::ComputeCycle>&, std::vector<unsigned int>&, const flexbar::AlignmentMode&) const’:
/<<PKGBUILDDIR>>/src/PairedAlign.h:109:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
109 | case BARCODE_READ: pRead->barID = m_b1->alignSeqRead(pRead->b, false, alBundle[0], cycle[0], idxAl[0], alMode, m_bTrimEnd, ""); break;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:109:94: error: request for member ‘b’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
109 | case BARCODE_READ: pRead->barID = m_b1->alignSeqRead(pRead->b, false, alBundle[0], cycle[0], idxAl[0], alMode, m_bTrimEnd, ""); break;
| ^
/<<PKGBUILDDIR>>/src/PairedAlign.h:110:59: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
110 | case WITHIN_READ_REMOVAL2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, true, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, "");
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:110:94: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
110 | case WITHIN_READ_REMOVAL2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, true, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, "");
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:111:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
111 | case WITHIN_READ_REMOVAL: pRead->barID = m_b1->alignSeqRead(pRead->r1, true, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:111:94: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
111 | case WITHIN_READ_REMOVAL: pRead->barID = m_b1->alignSeqRead(pRead->r1, true, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break;
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:112:59: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
112 | case WITHIN_READ2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, false, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, "");
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:112:94: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
112 | case WITHIN_READ2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, false, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, "");
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:113:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
113 | case WITHIN_READ: pRead->barID = m_b1->alignSeqRead(pRead->r1, false, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:113:94: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
113 | case WITHIN_READ: pRead->barID = m_b1->alignSeqRead(pRead->r1, false, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break;
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:117:27: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
117 | if(pRead->barID == 0 || (m_twoBarcodes && pRead->barID2 == 0)){
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:117:66: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
117 | if(pRead->barID == 0 || (m_twoBarcodes && pRead->barID2 == 0)){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h: In member function ‘void PairedAlign<TSeqStr, TString>::alignPairedReadToAdapters(flexbar::TPairedRead*, flexbar::TAlignBundle&, std::vector<flexbar::ComputeCycle>&, std::vector<unsigned int>&, const flexbar::AlignmentMode&, flexbar::TrimEnd) const’:
/<<PKGBUILDDIR>>/src/PairedAlign.h:132:58: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
132 | if(m_addBarcodeAdapter && pRead->r2 != NULL && pRead->barID2 > 0){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:132:79: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
132 | if(m_addBarcodeAdapter && pRead->r2 != NULL && pRead->barID2 > 0){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:133:69: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
133 | addBarcode = m_barcodes2->at(pRead->barID2 - 1).seq;
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:135:56: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
135 | if(m_umiTags && pRead->r2->umi != ""){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:139:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
139 | if(addBarcode[i] == 'N' && length(pRead->r2->umi) > umiPos){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:139:76: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
139 | if(addBarcode[i] == 'N' && length(pRead->r2->umi) > umiPos){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:140:80: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
140 | addBarcode[i] = pRead->r2->umi[umiPos++];
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:144:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
144 | seqan::reverseComplement(addBarcode);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:147:51: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
147 | m_a1->alignSeqRead(pRead->r1, true, alBundle[0], cycle[0], idxAl[0], alMode, trimEnd, addBarcode);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:150:27: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
150 | if(pRead->r2 != NULL && m_adapRem != AONE){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:154:58: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
154 | if(m_addBarcodeAdapter && pRead->barID > 0){
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:155:68: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
155 | addBarcode = m_barcodes->at(pRead->barID - 1).seq;
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:157:56: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
157 | if(m_umiTags && pRead->r1->umi != ""){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:161:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
161 | if(addBarcode[i] == 'N' && length(pRead->r1->umi) > umiPos){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:161:76: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
161 | if(addBarcode[i] == 'N' && length(pRead->r1->umi) > umiPos){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:162:80: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
162 | addBarcode[i] = pRead->r1->umi[umiPos++];
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:166:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
166 | seqan::reverseComplement(addBarcode);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:169:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
169 | if(m_adapRem != NORMAL2) m_a1->alignSeqRead(pRead->r2, true, alBundle[1], cycle[1], idxAl[1], alMode, trimEnd, addBarcode);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:170:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’}
170 | else m_a2->alignSeqRead(pRead->r2, true, alBundle[1], cycle[1], idxAl[1], alMode, trimEnd, addBarcode);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h: In member function ‘void PairedAlign<TSeqStr, TString>::trimLeftHPS(flexbar::TSeqRead*) const’:
/<<PKGBUILDDIR>>/src/PairedAlign.h:181:42: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
181 | if (seqRead->rmAdapter && (m_aTrimEnd == RIGHT || m_aTrimEnd == RTAIL)) return;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:182:42: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
182 | else if(seqRead->rmAdapterRC && (m_arcTrimEnd == RIGHT || m_arcTrimEnd == RTAIL)) return;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:188:51: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
188 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:188:73: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
188 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:197:77: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
197 | for(unsigned int i = 0; i < length(seqRead->seq); ++i){
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:197:61: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
197 | for(unsigned int i = 0; i < length(seqRead->seq); ++i){
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:199:53: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
199 | if(seqRead->seq[i] != nuc){
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:214:56: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
214 | erase(seqRead->seq, 0, cutPos);
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:214:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
214 | erase(seqRead->seq, 0, cutPos);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:217:64: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
217 | erase(seqRead->qual, 0, cutPos);
| ^~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:217:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-fpermissive]
217 | erase(seqRead->qual, 0, cutPos);
| ^~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h: In member function ‘void PairedAlign<TSeqStr, TString>::trimRightHPS(flexbar::TSeqRead*) const’:
/<<PKGBUILDDIR>>/src/PairedAlign.h:231:42: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
231 | if (seqRead->rmAdapter && (m_aTrimEnd == LEFT || m_aTrimEnd == LTAIL)) return;
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:232:42: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
232 | else if(seqRead->rmAdapterRC && (m_arcTrimEnd == LEFT || m_arcTrimEnd == LTAIL)) return;
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:238:51: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
238 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){
| ^~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:238:73: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
238 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){
| ^~~~~~~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:244:71: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
244 | unsigned int seqLen = length(seqRead->seq);
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:244:55: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
244 | unsigned int seqLen = length(seqRead->seq);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:250:53: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
250 | if(seqRead->seq[i] != nuc){
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:265:56: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
265 | erase(seqRead->seq, cutPos, length(seqRead->seq));
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:265:85: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
265 | erase(seqRead->seq, cutPos, length(seqRead->seq));
| ^~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:265:69: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
265 | erase(seqRead->seq, cutPos, length(seqRead->seq));
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:268:64: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
268 | erase(seqRead->qual, cutPos, length(seqRead->qual));
| ^~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:268:94: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’}
268 | erase(seqRead->qual, cutPos, length(seqRead->qual));
| ^~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:268:78: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-fpermissive]
268 | erase(seqRead->qual, cutPos, length(seqRead->qual));
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h: In member function ‘flexbar::TPairedReadBundle* PairedAlign<TSeqStr, TString>::operator()(flexbar::TPairedReadBundle*) const’:
/<<PKGBUILDDIR>>/src/PairedAlign.h:285:58: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
285 | prBundle->at(i)->r1->umi = "";
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:287:61: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
287 | if(prBundle->at(i)->r2 != NULL)
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:288:58: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
288 | prBundle->at(i)->r2->umi = "";
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:334:80: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
334 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:334:101: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
334 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:341:80: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
341 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:341:101: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
341 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:394:65: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:394:90: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:394:41: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:396:61: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
396 | if(prBundle->at(i)->r2 != NULL){
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:397:73: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:397:98: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:397:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:398:73: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:398:98: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:398:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:399:73: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:399:98: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:399:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-fpermissive]
399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi);
| ^~~~~~
/<<PKGBUILDDIR>>/src/PairedAlign.h:407:78: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
407 | trimLeftHPS(prBundle->at(i)->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:409:69: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
409 | if(prBundle->at(i)->r2 != NULL)
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:410:78: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
410 | trimLeftHPS(prBundle->at(i)->r2);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:415:79: error: request for member ‘r1’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
415 | trimRightHPS(prBundle->at(i)->r1);
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:417:69: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
417 | if(prBundle->at(i)->r2 != NULL)
| ^~
/<<PKGBUILDDIR>>/src/PairedAlign.h:418:79: error: request for member ‘r2’ in ‘i->prBundle->std::vector<int*>::at()->’, which is of non-class type ‘int’
418 | trimRightHPS(prBundle->at(i)->r2);
| ^~
/<<PKGBUILDDIR>>/src/Flexbar.h: In function ‘void loadAdapters(Options&, bool, bool)’:
/<<PKGBUILDDIR>>/src/Flexbar.h:116:37: error: ‘struct flexbar::TBar’ has no member named ‘id’
116 | bar.id = "cmdline";
| ^~
/<<PKGBUILDDIR>>/src/Flexbar.h:117:37: error: ‘struct flexbar::TBar’ has no member named ‘seq’
117 | bar.seq = o.adapterSeq;
| ^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:122:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’?
122 | seqan::reverseComplement(adapterSeqRC);
| ^~~~~~~~~~~~~~~~~
/usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here
334 | inline void reverseComplement(TText const & text)
| ^~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:125:39: error: ‘struct flexbar::TBar’ has no member named ‘id’
125 | barRC.id = "cmdline_rc";
| ^~
/<<PKGBUILDDIR>>/src/Flexbar.h:126:39: error: ‘struct flexbar::TBar’ has no member named ‘seq’
126 | barRC.seq = adapterSeqRC;
| ^~~
/<<PKGBUILDDIR>>/src/Flexbar.h: In function ‘void startComputation(Options&)’:
/<<PKGBUILDDIR>>/src/Flexbar.h:371:33: error: ‘FSeqStr’ was not declared in this scope
371 | loadBarcodesAndAdapters<FSeqStr, FString>(o);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:371:42: error: ‘FString’ was not declared in this scope
371 | loadBarcodesAndAdapters<FSeqStr, FString>(o);
| ^~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:371:50: error: no matching function for call to ‘loadBarcodesAndAdapters<<expression error>, <expression error> >(Options&)’
371 | loadBarcodesAndAdapters<FSeqStr, FString>(o);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:139:6: note: candidate: ‘template<class TSeqStr, class TString> void loadBarcodesAndAdapters(Options&)’
139 | void loadBarcodesAndAdapters(Options &o){
| ^~~~~~~~~~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:139:6: note: template argument deduction/substitution failed:
/<<PKGBUILDDIR>>/src/Flexbar.h:371:50: error: template argument 1 is invalid
371 | loadBarcodesAndAdapters<FSeqStr, FString>(o);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:371:50: error: template argument 2 is invalid
/<<PKGBUILDDIR>>/src/Flexbar.h:376:58: error: no matching function for call to ‘startProcessing<FSeqStr, FString>(Options&)’
376 | startProcessing<FSeqStr, FString>(o);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: candidate: ‘template<class TSeqStr, class TString> void startProcessing(Options&)’
224 | void startProcessing(Options &o){
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: template argument deduction/substitution failed:
/<<PKGBUILDDIR>>/src/Flexbar.h:388:58: error: no matching function for call to ‘startProcessing<FSeqStr, FString>(Options&)’
388 | startProcessing<FSeqStr, FString>(o);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: candidate: ‘template<class TSeqStr, class TString> void startProcessing(Options&)’
224 | void startProcessing(Options &o){
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: template argument deduction/substitution failed:
/<<PKGBUILDDIR>>/src/Flexbar.h:398:50: error: no matching function for call to ‘startProcessing<FSeqStr, FString>(Options&)’
398 | startProcessing<FSeqStr, FString>(o);
| ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: candidate: ‘template<class TSeqStr, class TString> void startProcessing(Options&)’
224 | void startProcessing(Options &o){
| ^~~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.h:224:6: note: template argument deduction/substitution failed:
/<<PKGBUILDDIR>>/src/Flexbar.cpp: In function ‘int main(int, const char**)’:
/<<PKGBUILDDIR>>/src/Flexbar.cpp:35:9: error: ‘ArgumentParser’ was not declared in this scope; did you mean ‘seqan2::ArgumentParser’?
35 | ArgumentParser parser("flexbar");
| ^~~~~~~~~~~~~~
| seqan2::ArgumentParser
/usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here
152 | class ArgumentParser
| ^~~~~~~~~~~~~~
/<<PKGBUILDDIR>>/src/Flexbar.cpp:37:23: error: ‘parser’ was not declared in this scope; did you mean ‘pause’?
37 | defineOptions(parser, version, date);
| ^~~~~~
| pause
/<<PKGBUILDDIR>>/src/Flexbar.cpp:37:9: error: ‘defineOptions’ was not declared in this scope; did you mean ‘initOptions’?
37 | defineOptions(parser, version, date);
| ^~~~~~~~~~~~~
| initOptions
/<<PKGBUILDDIR>>/src/Flexbar.cpp:38:9: error: ‘parseCmdLine’ was not declared in this scope
38 | parseCmdLine(parser, version, argc, argv);
| ^~~~~~~~~~~~
make[3]: *** [src/CMakeFiles/flexbar.dir/build.make:82: src/CMakeFiles/flexbar.dir/Flexbar.cpp.o] Error 1
make[3]: Leaving directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
make[2]: *** [CMakeFiles/Makefile2:109: src/CMakeFiles/flexbar.dir/all] Error 2
make[2]: Leaving directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
make[1]: *** [Makefile:94: all] Error 2
make[1]: Leaving directory '/<<PKGBUILDDIR>>/obj-aarch64-linux-gnu'
dh_auto_build: error: cd obj-aarch64-linux-gnu && make -j8 "INSTALL=install --strip-program=true" VERBOSE=1 returned exit code 2
make: *** [debian/rules:8: binary] Error 25
dpkg-buildpackage: error: debian/rules binary subprocess returned exit status 2
--------------------------------------------------------------------------------
Build finished at 2024-11-23T10:28:55Z
Finished
--------
+------------------------------------------------------------------------------+
| Cleanup |
+------------------------------------------------------------------------------+
Purging /<<BUILDDIR>>
Not cleaning session: cloned chroot in use
E: Build failure (dpkg-buildpackage died)
+------------------------------------------------------------------------------+
| Summary |
+------------------------------------------------------------------------------+
Build Architecture: arm64
Build Type: binary
Build-Space: 1344
Build-Time: 10
Distribution: sid
Fail-Stage: build
Host Architecture: arm64
Install-Time: 23
Job: /tmp/debusine-fetch-exec-upload-wy794es0/flexbar_3.5.0-5.dsc
Machine Architecture: arm64
Package: flexbar
Package-Time: 64
Source-Version: 1:3.5.0-5
Space: 1344
Status: attempted
Version: 1:3.5.0-5
--------------------------------------------------------------------------------
Finished at 2024-11-23T10:28:55Z
Build needed 00:01:04, 1344k disk space